Difference between revisions of "Nicotiana tabacum"
Jump to navigation
Jump to search
ICG Expert3 (talk | contribs) |
|||
| Line 37: | Line 37: | ||
* F:CCAACATTGTCACCAGGAAGTG | * F:CCAACATTGTCACCAGGAAGTG | ||
* R:NA | * R:NA | ||
| + | |align="center"| | ||
|align="center"| 67 | |align="center"| 67 | ||
|align="center"| SYBR | |align="center"| SYBR | ||
| − | |||
|- | |- | ||
|align="center"| Ntubc2<ref name="ref1"/> | |align="center"| Ntubc2<ref name="ref1"/> | ||
| Line 49: | Line 49: | ||
* F:CAGGATAATTTGCTGTAACAGATTA | * F:CAGGATAATTTGCTGTAACAGATTA | ||
* R:NA | * R:NA | ||
| + | |align="center"| | ||
|align="center"| 60 | |align="center"| 60 | ||
|align="center"| SYBR | |align="center"| SYBR | ||
| − | |||
|} | |} | ||
| + | |||
===Moleculer Type=== | ===Moleculer Type=== | ||
* mRNA | * mRNA | ||
Revision as of 02:43, 18 June 2017
Contents
Description
- Tobacco (Nicotiana tabacum) is an important model in studies of plant gene expression. The tobacco plant is generally robust and its nuclear and chloroplast genomes are readily transformed.
- Tobacco (Nicotiana tabacum), one of the most widely cultivated economic crops worldwide and grown in approximately 120 countries, including China, is a host for root-knot nematodes, which cause significant yield losses and plant mortality in field production[1] [2] .
Different Development Stages & Abiotic stress
Reference Genes
| Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
|---|---|---|---|---|---|---|---|
| L25[1] | L25 ribosomal protein | CCCCTCACCACAGAGTCTGC |
|
60 | SYBR | ||
| EF-1α[1] | Elongation factor 1α | TGAGATGCACCACGAAGCTC |
|
67 | SYBR | ||
| Ntubc2[1] | Ubiquitin-conjugating enzyme E2 | CTGGACAGCAGACTGACATC |
|
60 | SYBR |
Moleculer Type
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- ΔCt approach method && Related Reference
Contact
- Name: Sven K. Delaney
- Email: s.delaney@unsw.edu.au
- Institution: School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW 2052, Australia
Citation Statistics
Cited by 213 (Based on Google Scholar [2017-06-16])
References
- ↑ 1.0 1.1 1.2 1.3 Schmidt G W, Delaney S K. Stable internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana tabacum) during development and abiotic stress[J]. Molecular Genetics and Genomics, 2010, 283(3): 233-241.
- ↑ Xing X, Li X, Zhang M, et al. Transcriptome analysis of resistant and susceptible tobacco (Nicotiana tabacum) in response to root-knot nematode Meloidogyne incognita infection[J]. Biochemical and Biophysical Research Communications, 2017, 482(4): 1114-1121.
