Difference between revisions of "Nicotiana tabacum"

From ICG
Jump to navigation Jump to search
Line 20: Line 20:
 
|align="center"| L25 ribosomal protein  
 
|align="center"| L25 ribosomal protein  
 
|
 
|
[https://www.ncbi.nlm.nih.gov/nuccore/L18908 '''L18908''']
+
 
|align="center"| CCCCTCACCACAGAGTCTGC
+
|align="center"|[https://www.ncbi.nlm.nih.gov/nuccore/L18908 '''L18908''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:AAGGGTGTTGTTGTCCTCAATCTT
+
* F:CCCCTCACCACAGAGTCTGC
* R:NA
+
* R:AAGGGTGTTGTTGTCCTCAATCTT
|align="center"|  
+
|align="center"| NA
 
|align="center"| 60
 
|align="center"| 60
 
|align="center"| SYBR
 
|align="center"| SYBR
Line 32: Line 32:
 
|align="center"| Elongation factor 1α
 
|align="center"| Elongation factor 1α
 
|
 
|
[https://www.ncbi.nlm.nih.gov/nuccore/AF120093 '''AF120093''']
+
 
|align="center"| TGAGATGCACCACGAAGCTC
+
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AF120093 '''AF120093''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:CCAACATTGTCACCAGGAAGTG
+
* F:TGAGATGCACCACGAAGCTC
* R:NA
+
* R:CCAACATTGTCACCAGGAAGTG
|align="center"|  
+
|align="center"| NA
 
|align="center"| 67
 
|align="center"| 67
 
|align="center"| SYBR
 
|align="center"| SYBR
Line 44: Line 44:
 
|align="center"| Ubiquitin-conjugating enzyme E2
 
|align="center"| Ubiquitin-conjugating enzyme E2
 
|
 
|
[https://www.ncbi.nlm.nih.gov/nuccore/AB026056 '''AB026056''']
+
 
|align="center"| CTGGACAGCAGACTGACATC
+
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB026056 '''AB026056''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:CAGGATAATTTGCTGTAACAGATTA
+
* F:CTGGACAGCAGACTGACATC
* R:NA
+
* R:CAGGATAATTTGCTGTAACAGATTA
|align="center"|  
+
|align="center"| NA
 
|align="center"| 60
 
|align="center"| 60
 
|align="center"| SYBR
 
|align="center"| SYBR

Revision as of 02:45, 18 June 2017

Description

Nicotiana tabacum-1.jpg
  • Tobacco (Nicotiana tabacum) is an important model in studies of plant gene expression. The tobacco plant is generally robust and its nuclear and chloroplast genomes are readily transformed.
  • Tobacco (Nicotiana tabacum), one of the most widely cultivated economic crops worldwide and grown in approximately 120 countries, including China, is a host for root-knot nematodes, which cause significant yield losses and plant mortality in field production[1] [2] .

Different Development Stages & Abiotic stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
L25[1] L25 ribosomal protein L18908
  • F:CCCCTCACCACAGAGTCTGC
  • R:AAGGGTGTTGTTGTCCTCAATCTT
NA 60 SYBR
EF-1α[1] Elongation factor 1α AF120093
  • F:TGAGATGCACCACGAAGCTC
  • R:CCAACATTGTCACCAGGAAGTG
NA 67 SYBR
Ntubc2[1] Ubiquitin-conjugating enzyme E2 AB026056
  • F:CTGGACAGCAGACTGACATC
  • R:CAGGATAATTTGCTGTAACAGATTA
NA 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Sven K. Delaney
  • Email: s.delaney@unsw.edu.au
  • Institution: School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW 2052, Australia

Citation Statistics

Cited by 213 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Schmidt G W, Delaney S K. Stable internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana tabacum) during development and abiotic stress[J]. Molecular Genetics and Genomics, 2010, 283(3): 233-241.
  2. Xing X, Li X, Zhang M, et al. Transcriptome analysis of resistant and susceptible tobacco (Nicotiana tabacum) in response to root-knot nematode Meloidogyne incognita infection[J]. Biochemical and Biophysical Research Communications, 2017, 482(4): 1114-1121.