Difference between revisions of "Nicotiana tabacum"
Jump to navigation
Jump to search
(20 intermediate revisions by 6 users not shown) | |||
Line 1: | Line 1: | ||
=='''Description'''== | =='''Description'''== | ||
+ | [[File:Nicotiana tabacum.png|right|200px|link=Nicotiana tabacum]] | ||
+ | *'''''Nicotiana tabacum''''' is one of the most widely cultivated economic crops worldwide and grown in approximately 120 countries. It is a host for root-knot nematodes, which cause significant yield losses and plant mortality in field production. It is also an important model in studies of plant gene expression which is generally robust, the nuclear and chloroplast genomes are readily transformed<ref name="ref1"/><ref name="ref2"/> . | ||
+ | * <font color=blue>'''Common Name:'''</font> '''Tobacco''' | ||
+ | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4097 <font color=blue>'''NCBI Taxonomy'''</font>] | ||
− | + | =='''''Different Developmental Stages & Abiotic stress'''''== | |
− | + | ===Internal Control Genes=== | |
− | |||
− | =='''''Different | ||
− | === | ||
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 12: | Line 13: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 20: | Line 21: | ||
|align="center"| L25 ribosomal protein | |align="center"| L25 ribosomal protein | ||
| | | | ||
− | [https://www.ncbi.nlm.nih.gov/nuccore/L18908 '''L18908'''] | + | * Leaf, stem, root, anther and carpel |
− | + | * Heat, cold, cold, drought, UV irradiation | |
+ | |align="center"|[https://www.ncbi.nlm.nih.gov/nuccore/L18908 '''L18908'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
− | * F: | + | * F:CCCCTCACCACAGAGTCTGC |
− | * R:NA | + | * R:AAGGGTGTTGTTGTCCTCAATCTT |
+ | |align="center"| NA | ||
|align="center"| 60 | |align="center"| 60 | ||
|align="center"| SYBR | |align="center"| SYBR | ||
− | |||
|- | |- | ||
|align="center"| EF-1α<ref name="ref1"/> | |align="center"| EF-1α<ref name="ref1"/> | ||
|align="center"| Elongation factor 1α | |align="center"| Elongation factor 1α | ||
| | | | ||
− | [https://www.ncbi.nlm.nih.gov/nuccore/AF120093 '''AF120093'''] | + | * Leaf, stem, root, anther and carpel |
− | + | * Heat, cold, cold, drought, UV irradiation | |
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AF120093 '''AF120093'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
− | * F: | + | * F:TGAGATGCACCACGAAGCTC |
− | * R: | + | * R:CCAACATTGTCACCAGGAAGTG |
− | |align="center"| | + | |align="center"| NA |
|align="center"| 67 | |align="center"| 67 | ||
|align="center"| SYBR | |align="center"| SYBR | ||
Line 44: | Line 47: | ||
|align="center"| Ubiquitin-conjugating enzyme E2 | |align="center"| Ubiquitin-conjugating enzyme E2 | ||
| | | | ||
− | [https://www.ncbi.nlm.nih.gov/nuccore/AB026056 '''AB026056'''] | + | * Leaf, stem, root, anther and carpel |
− | + | * Heat, cold, cold, drought, UV irradiation | |
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB026056 '''AB026056'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
− | * F: | + | * F:CTGGACAGCAGACTGACATC |
− | * R: | + | * R:CAGGATAATTTGCTGTAACAGATTA |
− | |align="center"| | + | |align="center"| NA |
|align="center"| 60 | |align="center"| 60 | ||
|align="center"| SYBR | |align="center"| SYBR | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
* mRNA | * mRNA | ||
+ | |||
===Evaluation Methods=== | ===Evaluation Methods=== | ||
* [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
Line 65: | Line 70: | ||
*'''Institution''': School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW 2052, Australia | *'''Institution''': School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW 2052, Australia | ||
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by ''' | + | Cited by [https://scholar.google.com/scholar?cites=7533651121536535263&as_sdt=2005&sciodt=0,5&hl=en'''217'''] (Based on Google Scholar [2017-09-01]) |
=='''References'''== | =='''References'''== | ||
Line 76: | Line 81: | ||
</ref> | </ref> | ||
</references> | </references> | ||
− | [[Category:Plants]] | + | |
+ | =='''Categories'''== | ||
+ | [[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:EF1α]][[Category:RPL]][[Category:Ubiquitin]][[Category:Abiotic Stress]][[Category:Different Developmental Stages]][[Category:geNorm]][[Category:NormFinder]][[Category:Delta Ct]] |
Latest revision as of 07:11, 1 September 2017
Contents
Description
- Nicotiana tabacum is one of the most widely cultivated economic crops worldwide and grown in approximately 120 countries. It is a host for root-knot nematodes, which cause significant yield losses and plant mortality in field production. It is also an important model in studies of plant gene expression which is generally robust, the nuclear and chloroplast genomes are readily transformed[1][2] .
- Common Name: Tobacco
- NCBI Taxonomy
Different Developmental Stages & Abiotic stress
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
L25[1] | L25 ribosomal protein |
|
L18908 |
|
NA | 60 | SYBR |
EF-1α[1] | Elongation factor 1α |
|
AF120093 |
|
NA | 67 | SYBR |
Ntubc2[1] | Ubiquitin-conjugating enzyme E2 |
|
AB026056 |
|
NA | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- ΔCt approach method && Related Reference
Contact
- Name: Sven K. Delaney
- Email: s.delaney@unsw.edu.au
- Institution: School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW 2052, Australia
Citation Statistics
Cited by 217 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 1.3 Schmidt G W, Delaney S K. Stable internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana tabacum) during development and abiotic stress[J]. Molecular Genetics and Genomics, 2010, 283(3): 233-241.
- ↑ Xing X, Li X, Zhang M, et al. Transcriptome analysis of resistant and susceptible tobacco (Nicotiana tabacum) in response to root-knot nematode Meloidogyne incognita infection[J]. Biochemical and Biophysical Research Communications, 2017, 482(4): 1114-1121.