Difference between revisions of "Nicotiana tabacum"

From ICG
Jump to navigation Jump to search
 
(7 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:Nicotiana tabacum-1.jpg|right|327px|]]
+
[[File:Nicotiana tabacum.png|right|200px|link=Nicotiana tabacum]]
*'''''Nicotiana tabacum''''' is one of the most widely cultivated economic crops worldwide and grown in approximately 120 countries. It is a host for root-knot nematodes, which cause significant yield losses and plant mortality in field production. It is also an important model in studies of plant gene expression which is generally robust, the nuclear and chloroplast genomes are readily transformed<ref name="ref1"/> <ref name="ref2"/> .
+
*'''''Nicotiana tabacum''''' is one of the most widely cultivated economic crops worldwide and grown in approximately 120 countries. It is a host for root-knot nematodes, which cause significant yield losses and plant mortality in field production. It is also an important model in studies of plant gene expression which is generally robust, the nuclear and chloroplast genomes are readily transformed<ref name="ref1"/><ref name="ref2"/> .
 
* <font color=blue>'''Common Name:'''</font> '''Tobacco'''
 
* <font color=blue>'''Common Name:'''</font> '''Tobacco'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4097 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4097 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Developmental Stages & Abiotic stress'''''==
 
=='''''Different Developmental Stages & Abiotic stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 21: Line 21:
 
|align="center"| L25 ribosomal protein  
 
|align="center"| L25 ribosomal protein  
 
|
 
|
* Universal reference gene
+
* Leaf, stem, root, anther and carpel
 +
* Heat, cold, cold, drought, UV irradiation
 
|align="center"|[https://www.ncbi.nlm.nih.gov/nuccore/L18908 '''L18908''']
 
|align="center"|[https://www.ncbi.nlm.nih.gov/nuccore/L18908 '''L18908''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 33: Line 34:
 
|align="center"| Elongation factor 1α
 
|align="center"| Elongation factor 1α
 
|
 
|
* Universal reference gene
+
* Leaf, stem, root, anther and carpel
 +
* Heat, cold, cold, drought, UV irradiation
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AF120093 '''AF120093''']
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AF120093 '''AF120093''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 45: Line 47:
 
|align="center"| Ubiquitin-conjugating enzyme E2
 
|align="center"| Ubiquitin-conjugating enzyme E2
 
|
 
|
* Universal reference gene
+
* Leaf, stem, root, anther and carpel
 +
* Heat, cold, cold, drought, UV irradiation
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB026056 '''AB026056''']
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB026056 '''AB026056''']
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 67: Line 70:
 
*'''Institution''': School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW 2052, Australia
 
*'''Institution''': School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW 2052, Australia
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''213''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=7533651121536535263&as_sdt=2005&sciodt=0,5&hl=en'''217'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 78: Line 81:
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
+
 
[[Category:EF1α]] [[Category:RPL]] [[Category:Ubiquitin]][[Category:Abiotic Stress]] [[Category:Different Developmental Stages]]
+
=='''Categories'''==
 +
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:EF1α]][[Category:RPL]][[Category:Ubiquitin]][[Category:Abiotic Stress]][[Category:Different Developmental Stages]][[Category:geNorm]][[Category:NormFinder]][[Category:Delta Ct]]

Latest revision as of 07:11, 1 September 2017

Description

Nicotiana tabacum.png
  • Nicotiana tabacum is one of the most widely cultivated economic crops worldwide and grown in approximately 120 countries. It is a host for root-knot nematodes, which cause significant yield losses and plant mortality in field production. It is also an important model in studies of plant gene expression which is generally robust, the nuclear and chloroplast genomes are readily transformed[1][2] .
  • Common Name: Tobacco
  • NCBI Taxonomy

Different Developmental Stages & Abiotic stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
L25[1] L25 ribosomal protein
  • Leaf, stem, root, anther and carpel
  • Heat, cold, cold, drought, UV irradiation
L18908
  • F:CCCCTCACCACAGAGTCTGC
  • R:AAGGGTGTTGTTGTCCTCAATCTT
NA 60 SYBR
EF-1α[1] Elongation factor 1α
  • Leaf, stem, root, anther and carpel
  • Heat, cold, cold, drought, UV irradiation
AF120093
  • F:TGAGATGCACCACGAAGCTC
  • R:CCAACATTGTCACCAGGAAGTG
NA 67 SYBR
Ntubc2[1] Ubiquitin-conjugating enzyme E2
  • Leaf, stem, root, anther and carpel
  • Heat, cold, cold, drought, UV irradiation
AB026056
  • F:CTGGACAGCAGACTGACATC
  • R:CAGGATAATTTGCTGTAACAGATTA
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Sven K. Delaney
  • Email: s.delaney@unsw.edu.au
  • Institution: School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW 2052, Australia

Citation Statistics

Cited by 217 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Schmidt G W, Delaney S K. Stable internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana tabacum) during development and abiotic stress[J]. Molecular Genetics and Genomics, 2010, 283(3): 233-241.
  2. Xing X, Li X, Zhang M, et al. Transcriptome analysis of resistant and susceptible tobacco (Nicotiana tabacum) in response to root-knot nematode Meloidogyne incognita infection[J]. Biochemical and Biophysical Research Communications, 2017, 482(4): 1114-1121.

Categories