Difference between revisions of "Nicotiana tabacum"
Jump to navigation
Jump to search
(Created page with "=='''Description'''== =='''''Different Development Stages & Abiotic stress'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! G...") |
ICG Expert4 (talk | contribs) |
||
| Line 1: | Line 1: | ||
=='''Description'''== | =='''Description'''== | ||
| + | [[File:Nicotiana tabacum-1.jpg|right|327px|]] | ||
| + | * Tobacco (Nicotiana tabacum) is an important model in studies of plant gene expression. The tobacco plant is generally robust and its nuclear and chloroplast genomes are readily transformed. | ||
| + | * Tobacco (Nicotiana tabacum), one of the most widely cultivated economic crops worldwide and grown in approximately 120 countries, including China, is a host for root-knot nematodes, which cause significant yield losses and plant mortality in field production<ref name="ref1"/> <ref name="ref2"/> . | ||
=='''''Different Development Stages & Abiotic stress'''''== | =='''''Different Development Stages & Abiotic stress'''''== | ||
===Reference Genes=== | ===Reference Genes=== | ||
| Line 64: | Line 67: | ||
<ref name="ref1"> | <ref name="ref1"> | ||
Schmidt G W, Delaney S K. Stable internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana tabacum) during development and abiotic stress[J]. Molecular Genetics and Genomics, 2010, 283(3): 233-241. | Schmidt G W, Delaney S K. Stable internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana tabacum) during development and abiotic stress[J]. Molecular Genetics and Genomics, 2010, 283(3): 233-241. | ||
| + | </ref> | ||
| + | <ref name="ref2"> | ||
| + | Xing X, Li X, Zhang M, et al. Transcriptome analysis of resistant and susceptible tobacco (Nicotiana tabacum) in response to root-knot nematode Meloidogyne incognita infection[J]. Biochemical and Biophysical Research Communications, 2017, 482(4): 1114-1121. | ||
</ref> | </ref> | ||
</references> | </references> | ||
Revision as of 13:54, 16 June 2017
Contents
Description
- Tobacco (Nicotiana tabacum) is an important model in studies of plant gene expression. The tobacco plant is generally robust and its nuclear and chloroplast genomes are readily transformed.
- Tobacco (Nicotiana tabacum), one of the most widely cultivated economic crops worldwide and grown in approximately 120 countries, including China, is a host for root-knot nematodes, which cause significant yield losses and plant mortality in field production[1] [2] .
Different Development Stages & Abiotic stress
Reference Genes
| Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
|---|---|---|---|---|---|---|---|
| L25[1] | L25 ribosomal protein | CCCCTCACCACAGAGTCTGC |
|
60 | SYBR | ||
| EF-1α[1] | Elongation factor 1α | TGAGATGCACCACGAAGCTC |
|
67 | SYBR | ||
| Ntubc2[1] | Ubiquitin-conjugating enzyme E2 | CTGGACAGCAGACTGACATC |
|
60 | SYBR |
Moleculer Type
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- ΔCt approach method && Related Reference
Contact
- Name: Sven K. Delaney
- Email: s.delaney@unsw.edu.au
- Institution: School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW 2052, Australia
References
- ↑ 1.0 1.1 1.2 1.3 Schmidt G W, Delaney S K. Stable internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana tabacum) during development and abiotic stress[J]. Molecular Genetics and Genomics, 2010, 283(3): 233-241.
- ↑ Xing X, Li X, Zhang M, et al. Transcriptome analysis of resistant and susceptible tobacco (Nicotiana tabacum) in response to root-knot nematode Meloidogyne incognita infection[J]. Biochemical and Biophysical Research Communications, 2017, 482(4): 1114-1121.
