Nicotiana tabacum

From ICG
Jump to navigation Jump to search

Description

Nicotiana tabacum-1.jpg
  • Tobacco (Nicotiana tabacum) is an important model in studies of plant gene expression. The tobacco plant is generally robust and its nuclear and chloroplast genomes are readily transformed.
  • Tobacco (Nicotiana tabacum), one of the most widely cultivated economic crops worldwide and grown in approximately 120 countries, including China, is a host for root-knot nematodes, which cause significant yield losses and plant mortality in field production[1] [2] .
  • Common Name: Tobacco
  • NCBI Taxonomy

Different Developmental Stages & Abiotic stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
L25[1] L25 ribosomal protein
  • Universal reference gene
L18908
  • F:CCCCTCACCACAGAGTCTGC
  • R:AAGGGTGTTGTTGTCCTCAATCTT
NA 60 SYBR
EF-1α[1] Elongation factor 1α
  • Universal reference gene
AF120093
  • F:TGAGATGCACCACGAAGCTC
  • R:CCAACATTGTCACCAGGAAGTG
NA 67 SYBR
Ntubc2[1] Ubiquitin-conjugating enzyme E2
  • Universal reference gene
AB026056
  • F:CTGGACAGCAGACTGACATC
  • R:CAGGATAATTTGCTGTAACAGATTA
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Sven K. Delaney
  • Email: s.delaney@unsw.edu.au
  • Institution: School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW 2052, Australia

Citation Statistics

Cited by 213 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Schmidt G W, Delaney S K. Stable internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana tabacum) during development and abiotic stress[J]. Molecular Genetics and Genomics, 2010, 283(3): 233-241.
  2. Xing X, Li X, Zhang M, et al. Transcriptome analysis of resistant and susceptible tobacco (Nicotiana tabacum) in response to root-knot nematode Meloidogyne incognita infection[J]. Biochemical and Biophysical Research Communications, 2017, 482(4): 1114-1121.