Nicotiana tabacum

From ICG
Revision as of 12:44, 16 June 2017 by Xysj2012 (talk | contribs) (Created page with "=='''Description'''== =='''''Different Development Stages & Abiotic stress'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! G...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

Different Development Stages & Abiotic stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
L25[1] L25 ribosomal protein

L18908

CCCCTCACCACAGAGTCTGC
  • F:AAGGGTGTTGTTGTCCTCAATCTT
  • R:NA
60 SYBR
EF-1α[1] Elongation factor 1α

AF120093

TGAGATGCACCACGAAGCTC
  • F:CCAACATTGTCACCAGGAAGTG
  • R:NA
67 SYBR
Ntubc2[1] Ubiquitin-conjugating enzyme E2

AB026056

CTGGACAGCAGACTGACATC
  • F:CAGGATAATTTGCTGTAACAGATTA
  • R:NA
60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Sven K. Delaney
  • Email: s.delaney@unsw.edu.au
  • Institution: School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW 2052, Australia

References

  1. 1.0 1.1 1.2 Schmidt G W, Delaney S K. Stable internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana tabacum) during development and abiotic stress[J]. Molecular Genetics and Genomics, 2010, 283(3): 233-241.