Nicotiana tabacum
Jump to navigation
Jump to search
Contents
Description
Different Development Stages & Abiotic stress
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
L25[1] | L25 ribosomal protein | CCCCTCACCACAGAGTCTGC |
|
60 | SYBR | ||
EF-1α[1] | Elongation factor 1α | TGAGATGCACCACGAAGCTC |
|
67 | SYBR | ||
Ntubc2[1] | Ubiquitin-conjugating enzyme E2 | CTGGACAGCAGACTGACATC |
|
60 | SYBR |
Moleculer Type
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- ΔCt approach method && Related Reference
Contact
- Name: Sven K. Delaney
- Email: s.delaney@unsw.edu.au
- Institution: School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW 2052, Australia