Nilaparvata lugens

From ICG
Revision as of 07:14, 16 June 2017 by ICG Expert4 (talk | contribs) (Created page with "==Description== right|327px| * The brown planthopper (BPH), Nilaparvata lugens (N. lugens), is the most devastating rice pest in extensive areas...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

REFqPCR2014015-1.gif
  • The brown planthopper (BPH), Nilaparvata lugens (N. lugens), is the most devastating rice pest in extensive areas throughout Asia . The BPH ingests nutrients specifically from the phloem of rice plants with its stylet, causing the entire plant to become yellow and dry rapidly, a phenomenon referred to as hopperburn.
  • In addition, BPH is a vector of viruses that cause diseases in rice, such as Rice ragged stunt virus (RRSV) and Rice grassy stunt virus (RGSV). In recent years, N. lugens outbreaks have occurred more frequently in the Yangtze River Delta areas and in the South of China. Because of its long-distance migration, quick adaptation to resistant rice varieties and development of high resistance to pesticides, N. lugens infestations are difficult to control.
  • The brown planthopper (BPH), Nilaparvata lugens, is a major pest to rice production in many areas of Asia. It shows two wing forms, long (macropterous) and short (brachypterous) ones, in its adult stage. The macropterous adults possess the ability to migrate across long distances, while the brachypterous adults exemplify strong reproductive capacities. [1] [2].

Different Conditions

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RPS15[1] ribosomal protein S15
  • Different developmental stages, body parts & geographic populations
  • Different temperature and diet conditions
FJ810193
  • F:TAAAAATGGCAGACGAAGAGCCCAA
  • R:TTCCACGGTTGAAACGTCTGCG
150 60 EvaGreen
RPS11[1] ribosomal protein S11
  • Different developmental stages, body parts & geographic populations
  • Different temperature and diet conditions
FJ810197
  • F:CCGATCGTGTGGCGTTGAAGGG
  • R:ATGGCCGACATTCTTCCAGGTCC
159 60 EvaGreen
TUB[1] a-tubulin
  • Different developmental stages, body parts, and geographic populations
FJ810204
  • F:ACTCGTTCGGAGGAGGCACC
  • R:GTTCCAGGGTGGTGTGGGTGGT
174 60 EvaGreen

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jianhong Li
  • Email: jianhl@mail.hzau.edu.cn
  • Institution: Laboratory of Pesticide, College of Plant Science & Technology, Huazhong Agricultural University, Wuhan, China

References

  1. 1.0 1.1 1.2 1.3 Yuan M, Lu YH, Zhu X, et al. (2014) Selection and Evaluation of Potential Reference Genes for Gene Expression Analysis in the Brown Planthopper, Nilaparvata lugens (Hemiptera: Delphacidae) Using Reverse-Transcription Quantitative PCR. PLoS One 9.
  2. Dong XL, Zhai YF, Zhang JQ, et al. (2011) Fork head transcription factor is required for ovarian mature in the brown planthopper, Nilaparvata lugens (Stal). Bmc Molecular Biology 12.