Nilaparvata lugens

Description

Nilaparvata lugens is a major pest to rice production in many areas of Asia. It shows two wing forms, long (macropterous) and short (brachypterous) ones, in its adult stage. The macropterous adults possess the ability to migrate across long distances, while the brachypterous adults exemplify strong reproductive capacities. It ingests nutrients of rice and causes diseases in rice by being vector of viruses. In recent years, N. lugens outbreaks have occurred more frequently in the South of China. Because of its long-distance migration, quick adaptation to resistant rice varieties and development of high resistance to pesticides, N. lugens infestations are difficult to control^[1]^[2].
Common Name: Brown Planthopper
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
RPS15^[1]	Ribosomal protein S15	Different developmental stages, body parts & geographic populations Different temperature and diet conditions	FJ810193	F:TAAAAATGGCAGACGAAGAGCCCAA R:TTCCACGGTTGAAACGTCTGCG	150	60	EvaGreen
RPS11^[1]	Ribosomal protein S11	Different developmental stages, body parts & geographic populations Different temperature and diet conditions	FJ810197	F:CCGATCGTGTGGCGTTGAAGGG R:ATGGCCGACATTCTTCCAGGTCC	159	60	EvaGreen
TUB^[1]	A-tubulin	Different developmental stages, body parts, and geographic populations	FJ810204	F:ACTCGTTCGGAGGAGGCACC R:GTTCCAGGGTGGTGTGGGTGGT	174	60	EvaGreen

Name: Jianhong Li
Email: jianhl@mail.hzau.edu.cn
Institution: Laboratory of Pesticide, College of Plant Science & Technology, Huazhong Agricultural University, Wuhan, China

Cited by 56 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Yuan M, Lu YH, Zhu X, et al. (2014) Selection and Evaluation of Potential Reference Genes for Gene Expression Analysis in the Brown Planthopper, Nilaparvata lugens (Hemiptera: Delphacidae) Using Reverse-Transcription Quantitative PCR. PLoS One 9.
↑ Dong XL, Zhai YF, Zhang JQ, et al. (2011) Fork head transcription factor is required for ovarian mature in the brown planthopper, Nilaparvata lugens (Stal). Bmc Molecular Biology 12.