Difference between revisions of "Octopus vulgaris"
Jump to navigation
Jump to search
(→Brain) |
|||
| Line 16: | Line 16: | ||
! Detection | ! Detection | ||
|- | |- | ||
| − | |align="center"| | + | |align="center"| ubi<ref name="ref1"/> |
| − | |align="center"| | + | |align="center"| ubiquitin |
| | | | ||
* Universal reference gene | * Universal reference gene | ||
| − | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/ | + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/224037718 '''FJ617440'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
| − | * F: | + | * F:TCAAAACCGCCAACTTAACC |
| − | * R: | + | * R:CCTTCATTTGGTCCTTCGTC |
| − | |align="center"| | + | |align="center"| 113 |
|align="center"| 60 | |align="center"| 60 | ||
|align="center"| SYBR | |align="center"| SYBR | ||
|- | |- | ||
| − | |align="center"| | + | |align="center"| tubA<ref name="ref1"/> |
| − | |align="center"| | + | |align="center"| α-tubulin |
| | | | ||
* Universal reference gene | * Universal reference gene | ||
| − | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/ | + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/X15845 '''X15845'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
| − | * F: | + | * F:ACTGGTGTCCAACTGGCTTC |
| − | * R: | + | * R:TGCTTAACATGCACACAGCA |
| − | |align="center"| | + | |align="center"| 105 |
|align="center"| 60 | |align="center"| 60 | ||
|align="center"| SYBR | |align="center"| SYBR | ||
Revision as of 08:34, 17 June 2017
Contents
Description
- Octopus vulgaris is the most important octopus species in worldwide fisheries and represents a major protein resource in most fish-eating countries. It is of great commercial importance in Mediterranean, South American and Asian countries as well as in the NW Atlantic coasts of Spain and Portugal.[1] [2].
Brain
Reference Genes
| Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
|---|---|---|---|---|---|---|---|
| ubi[1] | ubiquitin |
|
FJ617440 |
|
113 | 60 | SYBR |
| tubA[1] | α-tubulin |
|
X15845 |
|
105 | 60 | SYBR |
Moleculer Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Graziano Fiorito
- Email: gfiorito@szn.it
- Institution: Laboratorio di Neurobiologia, Stazione Zoologica Anton Dohrn, Villa Comunale, 80121 Napoli, Italy
References
- ↑ 1.0 1.1 1.2 Sirakov M, Zarrella I, Borra M, Rizzo F, Biffali E, Arnone MI, Fiorito G. Selection and validation of a set of reliable reference genes for quantitative RT-PCR studies in the brain of the Cephalopod Mollusc Octopus vulgaris. BMC Mol Biol. 2009 Jul 14;10:70. doi: 10.1186/1471-2199-10-70. PubMed PMID: 19602224; PubMed Central PMCID: PMC2722649.
- ↑ Castellanos-Martínez S, Arteta D, Catarino S, Gestal C. De novo transcriptome sequencing of the Octopus vulgaris hemocytes using Illumina RNA-Seq technology: response to the infection by the gastrointestinal parasite Aggregata octopiana. PLoS One. 2014 Oct 16;9(10):e107873. doi: 10.1371/journal.pone.0107873. eCollection 2014. PubMed PMID: 25329466; PubMed Central PMCID: PMC4199593.
