Difference between revisions of "Octopus vulgaris"
Jump to navigation
Jump to search
Cao Jiabao (talk | contribs) |
|||
(23 intermediate revisions by 7 users not shown) | |||
Line 1: | Line 1: | ||
− | ==Description== | + | =='''Description'''== |
− | [[File: | + | [[File:Octopus vulgaris.png|right|200px|link=Octopus vulgaris]] |
− | * Octopus vulgaris is the most important octopus species in worldwide fisheries and represents a major protein resource in most fish-eating countries. It is of great commercial importance in Mediterranean, South American and Asian countries as well as in the NW Atlantic coasts of Spain and Portugal | + | * '''''Octopus vulgaris''''' is the most important octopus species in worldwide fisheries and represents a major protein resource in most fish-eating countries. It is of great commercial importance in Mediterranean, South American and Asian countries as well as in the NW Atlantic coasts of Spain and Portugal<ref name="ref1"/><ref name="ref2"/>. |
+ | * <font color=blue>'''Common Name:'''</font> '''Common octopus''' | ||
+ | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=6645 <font color=blue>'''NCBI Taxonomy'''</font>] | ||
=='''''Brain'''''== | =='''''Brain'''''== | ||
− | === | + | ===Internal Control Genes=== |
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primers (5'-3')<br>[Forward/Reverse] | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| ubi<ref name="ref1"/> | ||
+ | |align="center"| Ubiquitin | ||
+ | | | ||
+ | * Brain | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/224037718 '''FJ617440'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:TCAAAACCGCCAACTTAACC | ||
+ | * R:CCTTCATTTGGTCCTTCGTC | ||
+ | |align="center"| 113 | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| tubA<ref name="ref1"/> | ||
+ | |align="center"| α-tubulin | ||
+ | | | ||
+ | * Brain | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/X15845 '''X15845'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:ACTGGTGTCCAACTGGCTTC | ||
+ | * R:TGCTTAACATGCACACAGCA | ||
+ | |align="center"| 105 | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | |||
+ | ===Molecular Types=== | ||
*mRNA | *mRNA | ||
+ | |||
===Evaluation Methods=== | ===Evaluation Methods=== | ||
* [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
Line 14: | Line 54: | ||
*'''Email''': gfiorito@szn.it | *'''Email''': gfiorito@szn.it | ||
*'''Institution''': Laboratorio di Neurobiologia, Stazione Zoologica Anton Dohrn, Villa Comunale, 80121 Napoli, Italy | *'''Institution''': Laboratorio di Neurobiologia, Stazione Zoologica Anton Dohrn, Villa Comunale, 80121 Napoli, Italy | ||
+ | |||
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=7404353325846467532&as_sdt=2005&sciodt=0,5&hl=en '''20'''] (Based on Google Scholar [2017-09-01]) | ||
=='''References'''== | =='''References'''== | ||
Line 32: | Line 75: | ||
</ref> | </ref> | ||
</references> | </references> | ||
+ | =='''Categories'''== | ||
+ | [[Category:Animals]] | ||
+ | [[Category:mRNA]] | ||
+ | [[Category:SYBR]] | ||
+ | [[Category:Tubulin]] [[Category:Ubiquitin]][[Category:Specific Tissue]] [[Category:Brain Tissue]] | ||
+ | |||
+ | [[Category:geNorm]] | ||
+ | [[Category:NormFinder]] | ||
+ | [[Category:BestKeeper]] |
Latest revision as of 04:22, 1 September 2017
Contents
Description
- Octopus vulgaris is the most important octopus species in worldwide fisheries and represents a major protein resource in most fish-eating countries. It is of great commercial importance in Mediterranean, South American and Asian countries as well as in the NW Atlantic coasts of Spain and Portugal[1][2].
- Common Name: Common octopus
- NCBI Taxonomy
Brain
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
ubi[1] | Ubiquitin |
|
FJ617440 |
|
113 | 60 | SYBR |
tubA[1] | α-tubulin |
|
X15845 |
|
105 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Graziano Fiorito
- Email: gfiorito@szn.it
- Institution: Laboratorio di Neurobiologia, Stazione Zoologica Anton Dohrn, Villa Comunale, 80121 Napoli, Italy
Citation Statistics
Cited by 20 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 Sirakov M, Zarrella I, Borra M, Rizzo F, Biffali E, Arnone MI, Fiorito G. Selection and validation of a set of reliable reference genes for quantitative RT-PCR studies in the brain of the Cephalopod Mollusc Octopus vulgaris. BMC Mol Biol. 2009 Jul 14;10:70. doi: 10.1186/1471-2199-10-70. PubMed PMID: 19602224; PubMed Central PMCID: PMC2722649.
- ↑ Castellanos-Martínez S, Arteta D, Catarino S, Gestal C. De novo transcriptome sequencing of the Octopus vulgaris hemocytes using Illumina RNA-Seq technology: response to the infection by the gastrointestinal parasite Aggregata octopiana. PLoS One. 2014 Oct 16;9(10):e107873. doi: 10.1371/journal.pone.0107873. eCollection 2014. PubMed PMID: 25329466; PubMed Central PMCID: PMC4199593.