Difference between revisions of "Octopus vulgaris"

From ICG
Jump to navigation Jump to search
 
(19 intermediate revisions by 7 users not shown)
Line 1: Line 1:
==Description==
+
=='''Description'''==
[[File:REFqPCR200902.jpg|right|127px|]]
+
[[File:Octopus vulgaris.png|right|200px|link=Octopus vulgaris]]
* Octopus vulgaris is the most important octopus species in worldwide fisheries and represents a major protein resource in most fish-eating countries. It is of great commercial importance in Mediterranean, South American and Asian countries as well as in the NW Atlantic coasts of Spain and Portugal.<ref name="ref1"/> <ref name="ref2"/>.
+
* '''''Octopus vulgaris''''' is the most important octopus species in worldwide fisheries and represents a major protein resource in most fish-eating countries. It is of great commercial importance in Mediterranean, South American and Asian countries as well as in the NW Atlantic coasts of Spain and Portugal<ref name="ref1"/><ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Common octopus'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=6645 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Brain'''''==
 
=='''''Brain'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 11: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 17: Line 19:
 
|-
 
|-
 
|align="center"| ubi<ref name="ref1"/>
 
|align="center"| ubi<ref name="ref1"/>
|align="center"| ubiquitin
+
|align="center"| Ubiquitin
 
|
 
|
* Universal reference gene
+
* Brain
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/224037718 '''FJ617440''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/224037718 '''FJ617440''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 31: Line 33:
 
|align="center"| α-tubulin
 
|align="center"| α-tubulin
 
|
 
|
* Universal reference gene
+
* Brain
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/X15845 '''X15845''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/X15845 '''X15845''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 41: Line 43:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 51: Line 54:
 
*'''Email''': gfiorito@szn.it
 
*'''Email''': gfiorito@szn.it
 
*'''Institution''': Laboratorio di Neurobiologia, Stazione Zoologica Anton Dohrn, Villa Comunale, 80121 Napoli, Italy
 
*'''Institution''': Laboratorio di Neurobiologia, Stazione Zoologica Anton Dohrn, Villa Comunale, 80121 Napoli, Italy
 +
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=7404353325846467532&as_sdt=2005&sciodt=0,5&hl=en '''20'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 69: Line 75:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 +
[[Category:Animals]]
 +
[[Category:mRNA]]
 +
[[Category:SYBR]]
 +
[[Category:Tubulin]] [[Category:Ubiquitin]][[Category:Specific Tissue]]  [[Category:Brain Tissue]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 04:22, 1 September 2017

Description

Octopus vulgaris.png
  • Octopus vulgaris is the most important octopus species in worldwide fisheries and represents a major protein resource in most fish-eating countries. It is of great commercial importance in Mediterranean, South American and Asian countries as well as in the NW Atlantic coasts of Spain and Portugal[1][2].
  • Common Name: Common octopus
  • NCBI Taxonomy

Brain

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ubi[1] Ubiquitin
  • Brain
FJ617440
  • F:TCAAAACCGCCAACTTAACC
  • R:CCTTCATTTGGTCCTTCGTC
113 60 SYBR
tubA[1] α-tubulin
  • Brain
X15845
  • F:ACTGGTGTCCAACTGGCTTC
  • R:TGCTTAACATGCACACAGCA
105 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Graziano Fiorito
  • Email: gfiorito@szn.it
  • Institution: Laboratorio di Neurobiologia, Stazione Zoologica Anton Dohrn, Villa Comunale, 80121 Napoli, Italy

Citation Statistics

Cited by 20 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Sirakov M, Zarrella I, Borra M, Rizzo F, Biffali E, Arnone MI, Fiorito G. Selection and validation of a set of reliable reference genes for quantitative RT-PCR studies in the brain of the Cephalopod Mollusc Octopus vulgaris. BMC Mol Biol. 2009 Jul 14;10:70. doi: 10.1186/1471-2199-10-70. PubMed PMID: 19602224; PubMed Central PMCID: PMC2722649.
  2. Castellanos-Martínez S, Arteta D, Catarino S, Gestal C. De novo transcriptome sequencing of the Octopus vulgaris hemocytes using Illumina RNA-Seq technology: response to the infection by the gastrointestinal parasite Aggregata octopiana. PLoS One. 2014 Oct 16;9(10):e107873. doi: 10.1371/journal.pone.0107873. eCollection 2014. PubMed PMID: 25329466; PubMed Central PMCID: PMC4199593.

Categories