Difference between revisions of "Oenococcus oeni"

From ICG
Jump to navigation Jump to search
Line 21: Line 21:
 
|align="center"| Filamenting temperature-sensitive mutant Z
 
|align="center"| Filamenting temperature-sensitive mutant Z
 
|
 
|
*ethanol
+
* Ethanol
* butyric acid
+
* Butyric acid
* ethyl butyrate
+
* Ethyl butyrate
 
|align="center"| NA  
 
|align="center"| NA  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 35: Line 35:
 
|align="center"| Phosphotransacetylase  
 
|align="center"| Phosphotransacetylase  
 
|
 
|
*ethanol
+
* Ethanol
* butyric acid
+
* Butyric acid
* ethyl butyrate
+
* Ethyl butyrate
 
|align="center"| NA  
 
|align="center"| NA  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 49: Line 49:
 
|align="center"| D -glyceraldehyde-3-phosphate dehydrogenase
 
|align="center"| D -glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
*ethanol
+
* Ethanol
* butyric acid
+
* Butyric acid
* ethyl butyrate
+
* Ethyl butyrate
 
|align="center"| NA  
 
|align="center"| NA  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 63: Line 63:
 
|align="center"| Sigma α factor
 
|align="center"| Sigma α factor
 
|
 
|
*ethanol
+
* Ethanol
* butyric acid
+
* Butyric acid
* ethyl butyrate
+
* Ethyl butyrate
 
|align="center"| NA  
 
|align="center"| NA  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|

Revision as of 01:56, 15 August 2017

Description

Oenococcus oeni-1.jpg
  • Oenococcus oeni, (formerly Leuconostoc oenos), is the lactic acid bacterium most often involved in spontaneous malolactic fermentation (MLF) of wine. Peculiar biotypes of this species are used increasingly as starter cultures to enhance the organoleptic properties and micro- biological stability of red and white wines. Oenococcus oeni strains are generally difficult to isolate; they also grow slowly and are therefore difficult to study and characterize [1][2].
  • Common Name: Unknown
  • NCBI Taxonomy

Whole Cell Under Various Culture Conditions

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ftsZ[2] Filamenting temperature-sensitive mutant Z
  • Ethanol
  • Butyric acid
  • Ethyl butyrate
NA
  • F:TGCCGGATCGACACCTGA
  • R:CGGACGAGTAACAACGCCAAC
NA 60
pta[2] Phosphotransacetylase
  • Ethanol
  • Butyric acid
  • Ethyl butyrate
NA
  • F:CATGGCTGAGATTGCCGTTC
  • R:TCTCCTGCGCCAGCTTAGT
NA 60
gapA[2] D -glyceraldehyde-3-phosphate dehydrogenase
  • Ethanol
  • Butyric acid
  • Ethyl butyrate
NA
  • F:TCCACGCTTACACATCGACTCA
  • R:CGCTGAGCATGACCATTCAAC
NA 60
rpoA[2] Sigma α factor
  • Ethanol
  • Butyric acid
  • Ethyl butyrate
NA
  • F:GATGGAACTTGGCATTGGTG
  • R:AAGACTCGCTTGGACTAACAGAAC
NA 60

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Vladimir Jiranek
  • Email: vladimir.jiranek@adelaide.edu.au
  • Institute: School of Agriculture, Food and Wine, TheUniversityofAdelaide, PMB 1, Glen Osmond, Adelaide, SA 5064, Australia

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-08-10])

References

  1. Zapparoli G, Torriani S, Pesente P, et al. Design and evaluation of malolactic enzyme gene targeted primers for rapid identification and detection of Oenococcus oeni in wine[J]. Letters in Applied Microbiology, 1998, 27(5): 243-246.
  2. 2.0 2.1 2.2 2.3 2.4 Sumby, Krista M., Paul R. Grbin, and Vladimir Jiranek. "Validation of the use of multiple internal control genes, and the application of real-time quantitative PCR, to study esterase gene expression in Oenococcus oeni." Applied microbiology and biotechnology 96.4 (2012): 1039-1047.

Categories