Oenococcus oeni

From ICG
Jump to navigation Jump to search

Description

Oenococcus oeni-1.jpg
  • Oenococcus oeni, (formerly Leuconostoc oenos), is the lactic acid bacterium most often involved in spontaneous malolactic fermentation (MLF) of wine. Peculiar biotypes of this species are used increasingly as starter cultures to enhance the organoleptic properties and micro- biological stability of red and white wines. Oenococcus oeni strains are generally difficult to isolate; they also grow slowly and are therefore difficult to study and characterize [1][2].
  • Common Name: Unknown
  • NCBI Taxonomy

Whole Cell Under Various Culture Conditions

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ftsZ[3] Filamenting temperature-sensitive mutant Z
  • ethanol
  • butyric acid
  • ethyl butyrate
NA
  • F:TGCCGGATCGACACCTGA
  • R:CGGACGAGTAACAACGCCAAC
NA 60
pta[3] Phosphotransacetylase
  • ethanol
  • butyric acid
  • ethyl butyrate
NA
  • F:CATGGCTGAGATTGCCGTTC
  • R:TCTCCTGCGCCAGCTTAGT
NA 60
gapA[3] D -glyceraldehyde-3-phosphate dehydrogenase
  • ethanol
  • butyric acid
  • ethyl butyrate
NA
  • F:TCCACGCTTACACATCGACTCA
  • R:CGCTGAGCATGACCATTCAAC
NA 60
rpoA[3] Sigma α factor
  • ethanol
  • butyric acid
  • ethyl butyrate
NA
  • F:GATGGAACTTGGCATTGGTG
  • R:AAGACTCGCTTGGACTAACAGAAC
NA 60

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Vladimir Jiranek
  • Email: vladimir.jiranek@adelaide.edu.au
  • Institute: School of Agriculture, Food and Wine, TheUniversityofAdelaide, PMB 1, Glen Osmond, Adelaide, SA 5064, Australia

Citation Statistics

Cited by ?? (Based on Google Scholar [2017-08-01])

References

  1. Sumby KM, Grbin PR, Jiranek V. Validation of the use of multiple internal control genes, and the application of real-time quantitative PCR, to study esterase gene expression in Oenococcus oeni. Appl Microbiol Biotechnol. 2012 Nov;96(4):1039-47. doi: 10.1007/s00253-012-4409-1. Epub 2012 Sep 29. PubMed PMID:23053071.
  2. Costantini A, Vaudano E, Rantsiou K, Cocolin L, Garcia-Moruno E (2011) Quantitative expression analysis of mleP gene and two genes involved in the ABC transport system in Oenococcus oeni during rehydration. Appl Microbiol Biotechnol 91(6):1601–1609
  3. 3.0 3.1 3.2 3.3 Sumby, Krista M., Paul R. Grbin, and Vladimir Jiranek. "Validation of the use of multiple internal control genes, and the application of real-time quantitative PCR, to study esterase gene expression in Oenococcus oeni." Applied microbiology and biotechnology 96.4 (2012): 1039-1047.

Categories