Difference between revisions of "Oreochromis niloticus"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== =='''''Different Tissues & Infection'''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gen...")
 
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
  
=='''''Different Tissues & Infection'''==
+
=='''''Different Tissues & Infection'''''==
 
===Reference Genes===
 
===Reference Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"

Revision as of 09:27, 16 June 2017

Description

Different Tissues & Infection

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
UBCE[1] Ubiquitin-conjugating enzyme
  • in the intestine, liver, brain, kidney, and spleen after S. iniae infection, and in the liver, kidney, and spleen after S. agalactiae infection
XM_003460024
  • F:CTCTCAAATCAATGCCACTTCC
  • R:CCCTGGTGGAGGTTCCTTGT
130 59 SYBR
EF1A[1] EF-1a mRNA for elongation factor 1a
  • heart and muscle after S. iniae or S. agalactiae infection
AB075952
  • F:GCACGCTCTGCTGGCCTTT
  • R:GCGCTCAATCTTCCATCCC
250 59 SYBR
GADPH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • in intestine and brain after S. agalactiae infection
JN381952
  • F:GATAATGGCAAACTTGTCGTCG
  • R:ACATTGGAGCATCGGGTGAG
205 59 SYBR
18S rRNA[1] 18S ribosomal RNA
  • across the various tissues
JF698683
  • F:GGACACGGAAAGGATTGACAG
  • R:GTTCGTTATCGGAATTAACCAGAC
111 59 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Hua Wen
  • Email: wenhua.hb@163.com
  • Institution: Key Laboratory of Freshwater Biodiversity Conservation and Utilization of Ministry of Agriculture, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China

References

  1. 1.0 1.1 1.2 1.3 Yang C G, Wang X L, Tian J, et al. Evaluation of reference genes for quantitative real-time RT-PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus)[J]. Gene, 2013, 527(1): 183-192.