Difference between revisions of "Oreochromis niloticus"

From ICG
Jump to navigation Jump to search
 
(25 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
−
[[File:Oreoc niloti-thumb.jpg|right|237px]]
+
[[File:Oreochromis niloticus.png|right|200px|link=Oreochromis niloticus]]
−
*The Nile tilapia (Oreochromis niloticus) is a species of tilapia, a cichlid fish native to Africa from Egypt south to east and central Africa, and as far west as Gambia.  
+
*'''''Oreochromis niloticus''''' is a species of tilapia, a cichlid fish native to Africa from Egypt south to east and central Africa, and as far west as Gambia. It is also native to Israel, and numerous introduced populations exist outside its natural range. As a gonochoristic teleost fish with an XX/XY sex-determining system, it provides an excellent model for studying gonadal sex differentiation because genetic all-females and all-males are available<ref name="ref1"/><ref name="ref2"/>.
−
*It is also native to Israel, and numerous introduced populations exist outside its natural range (e.g., Brazil).[2] It is also commercially known as mango fish, nilotica, or boulti.
+
* <font color=blue>'''Common Name:'''</font> '''Nile tilapia'''
−
*The Nile tilapia, a gonochoristic teleost fish with an XX/XY sex-determining system, provides an excellent model for studying gonadal sex differentiation because genetic all-females and all-males are available<ref name="ref1"/><ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=8128 <font color=blue>'''NCBI Taxonomy'''</font>]
  
−
=='''''Different Tissues & Infection'''''==
+
=='''''Different Tissues & Bacterial Infection'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 13:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 66: Line 66:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
−
===Moleculer Type===
+
 
 +
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 76: Line 78:
 
*'''Institution''': Key Laboratory of Freshwater Biodiversity Conservation and Utilization of Ministry of Agriculture, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China
 
*'''Institution''': Key Laboratory of Freshwater Biodiversity Conservation and Utilization of Ministry of Agriculture, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''32''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=14898861311637760106&as_sdt=2005&sciodt=0,5&hl=en '''33''' ](Based on Google Scholar [2017-09-01])
 +
 
 +
=='''''Vaccination & Infection'''''==
 +
===Internal Control Genes===
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Gene Symbol 
 +
! Gene Name
 +
! style="width=25%　font-size:9pt　"|Application Scope
 +
! Accession Number
 +
! Primers (5'-3')<br>[Forward/Reverse]
 +
! Size [bp]
 +
! Tm [℃]
 +
! Detection
 +
|-
 +
|align="center"| EF1A<ref name="ref3"/>
 +
|align="center"| Elongation factor 1 α
 +
|
 +
*Vaccination and infection
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB075952 '''AB075952''']
 +
|nowrap style="font-size:9pt"|
 +
* F:GCACGCTCTGCTGGCCTTT
 +
* R:GCGCTCAATCTTCCATCCC
 +
|align="center"| 250
 +
|align="center"| 59
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| ACTB<ref name="ref3"/>
 +
|align="center"| β-actin 
 +
|
 +
*Vaccination and infection
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_003443127 '''XM_003443127''']
 +
|nowrap style="font-size:9pt"|
 +
* F:GACCCACACAGTGCCCATCT
 +
* R:TCTCGGCTGTGGTGGTGAA
 +
|align="center"| 140
 +
|align="center"| 59
 +
|align="center"| SYBR
 +
|}
 +
 
 +
===Molecular Types===
 +
* mRNA
 +
 
 +
===Evaluation Methods===
 +
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 +
*  '''Ref-Finder method''' && [https://www.ncbi.nlm.nih.gov/pubmed/22290409 '''Related Reference''']
 +
===Contact===
 +
*'''Name''': Kaiyu Wang
 +
*'''Email''': kywangsicau@126.com
 +
*'''Institution''': Department of Basic Veterinary, Sichuan Agricultural University, Wenjiang District Huimin Road No. 211, Chengdu 611130, China
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=977892631141254526&as_sdt=2005&sciodt=0,5&hl=en '''11''' ](Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 88: Line 141:
 
differentiation of a teleost fish, the Nile tilapia Oreochromis niloticus. Biol
 
differentiation of a teleost fish, the Nile tilapia Oreochromis niloticus. Biol
 
Reprod. 2008 Feb;78(2):333-41. Epub 2007 Oct 17. PubMed PMID: 17942796.
 
Reprod. 2008 Feb;78(2):333-41. Epub 2007 Oct 17. PubMed PMID: 17942796.
 +
</ref>
 +
<ref name="ref3">
 +
Wang, Erlong, et al. "Evaluation and selection of appropriate reference genes for real-time quantitative PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus) during vaccination and infection." International journal of molecular sciences 16.5 (2015): 9998-10015.
 
</ref>
 
</ref>
 
</references>
 
</references>
−
 
+
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
  
 
[[Category:mRNA]]
 
[[Category:mRNA]]
 +
[[Category:ACT]]
 +
[[Category:SYBR]]
 +
[[Category:18S rRNA]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:Ubiquitin]]
 +
[[Category:Different Tissues]]  [[Category:Biotic Stress]]  [[Category:Pathological conditions]]  [[Category:Bacterial Infection]]
  
−
[[Category:SYBR]]
+
[[Category:geNorm]]
 +
 
 +
[[Category:RefFinder]]

Latest revision as of 04:29, 1 September 2017

Description

Oreochromis niloticus.png
  • Oreochromis niloticus is a species of tilapia, a cichlid fish native to Africa from Egypt south to east and central Africa, and as far west as Gambia. It is also native to Israel, and numerous introduced populations exist outside its natural range. As a gonochoristic teleost fish with an XX/XY sex-determining system, it provides an excellent model for studying gonadal sex differentiation because genetic all-females and all-males are available[1][2].
  • Common Name: Nile tilapia
  • NCBI Taxonomy

Different Tissues & Bacterial Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
UBCE[1] Ubiquitin-conjugating enzyme
  • In the intestine, liver, brain, kidney, and spleen after S. iniae infection, and in the liver, kidney, and spleen after S. agalactiae infection
 XM_003460024
  • F:CTCTCAAATCAATGCCACTTCC
  • R:CCCTGGTGGAGGTTCCTTGT
 130 59 SYBR
EF1A[1] EF-1a mRNA for elongation factor 1a
  • Heart and muscle after S. iniae or S. agalactiae infection
 AB075952
  • F:GCACGCTCTGCTGGCCTTT
  • R:GCGCTCAATCTTCCATCCC
 250 59 SYBR
GADPH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • In intestine and brain after S. agalactiae infection
 JN381952
  • F:GATAATGGCAAACTTGTCGTCG
  • R:ACATTGGAGCATCGGGTGAG
 205 59 SYBR
18S rRNA[1] 18S ribosomal RNA
  • Across the various tissues
 JF698683
  • F:GGACACGGAAAGGATTGACAG
  • R:GTTCGTTATCGGAATTAACCAGAC
 111 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Hua Wen
  • Email: wenhua.hb@163.com
  • Institution: Key Laboratory of Freshwater Biodiversity Conservation and Utilization of Ministry of Agriculture, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China

Citation Statistics

Cited by 33 (Based on Google Scholar [2017-09-01])

Vaccination & Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
EF1A[3] Elongation factor 1 α
  • Vaccination and infection
 AB075952
  • F:GCACGCTCTGCTGGCCTTT
  • R:GCGCTCAATCTTCCATCCC
 250 59 SYBR
ACTB[3] β-actin
  • Vaccination and infection
 XM_003443127
  • F:GACCCACACAGTGCCCATCT
  • R:TCTCGGCTGTGGTGGTGAA
 140 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Kaiyu Wang
  • Email: kywangsicau@126.com
  • Institution: Department of Basic Veterinary, Sichuan Agricultural University, Wenjiang District Huimin Road No. 211, Chengdu 611130, China

Citation Statistics

Cited by 11 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 Yang C G, Wang X L, Tian J, et al. Evaluation of reference genes for quantitative real-time RT-PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus)[J]. Gene, 2013, 527(1): 183-192.
  2. ↑ Ijiri S, Kaneko H, Kobayashi T, Wang DS, Sakai F, Paul-Prasanth B, Nakamura M, Nagahama Y. Sexual dimorphic expression of genes in gonads during early differentiation of a teleost fish, the Nile tilapia Oreochromis niloticus. Biol Reprod. 2008 Feb;78(2):333-41. Epub 2007 Oct 17. PubMed PMID: 17942796.
  3. ↑ 3.0 3.1 Wang, Erlong, et al. "Evaluation and selection of appropriate reference genes for real-time quantitative PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus) during vaccination and infection." International journal of molecular sciences 16.5 (2015): 9998-10015.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Oreochromis_niloticus&oldid=8548"