Difference between revisions of "Oreochromis niloticus"
Jump to navigation
Jump to search
ICG Expert3 (talk | contribs) |
Cao Jiabao (talk | contribs) |
||
(19 intermediate revisions by 5 users not shown) | |||
Line 1: | Line 1: | ||
=='''Description'''== | =='''Description'''== | ||
− | [[File: | + | [[File:Oreochromis niloticus.png|right|200px|link=Oreochromis niloticus]] |
− | * | + | *'''''Oreochromis niloticus''''' is a species of tilapia, a cichlid fish native to Africa from Egypt south to east and central Africa, and as far west as Gambia. It is also native to Israel, and numerous introduced populations exist outside its natural range. As a gonochoristic teleost fish with an XX/XY sex-determining system, it provides an excellent model for studying gonadal sex differentiation because genetic all-females and all-males are available<ref name="ref1"/><ref name="ref2"/>. |
− | + | * <font color=blue>'''Common Name:'''</font> '''Nile tilapia''' | |
− | + | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=8128 <font color=blue>'''NCBI Taxonomy'''</font>] | |
=='''''Different Tissues & Bacterial Infection'''''== | =='''''Different Tissues & Bacterial Infection'''''== | ||
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 66: | Line 66: | ||
|align="center"| SYBR | |align="center"| SYBR | ||
|} | |} | ||
+ | |||
===Molecular Types=== | ===Molecular Types=== | ||
* mRNA | * mRNA | ||
Line 77: | Line 78: | ||
*'''Institution''': Key Laboratory of Freshwater Biodiversity Conservation and Utilization of Ministry of Agriculture, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China | *'''Institution''': Key Laboratory of Freshwater Biodiversity Conservation and Utilization of Ministry of Agriculture, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China | ||
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by ''' | + | Cited by [https://scholar.google.com/scholar?cites=14898861311637760106&as_sdt=2005&sciodt=0,5&hl=en '''33''' ](Based on Google Scholar [2017-09-01]) |
+ | |||
+ | =='''''Vaccination & Infection'''''== | ||
+ | ===Internal Control Genes=== | ||
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primers (5'-3')<br>[Forward/Reverse] | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| EF1A<ref name="ref3"/> | ||
+ | |align="center"| Elongation factor 1 α | ||
+ | | | ||
+ | *Vaccination and infection | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB075952 '''AB075952'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GCACGCTCTGCTGGCCTTT | ||
+ | * R:GCGCTCAATCTTCCATCCC | ||
+ | |align="center"| 250 | ||
+ | |align="center"| 59 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| ACTB<ref name="ref3"/> | ||
+ | |align="center"| β-actin | ||
+ | | | ||
+ | *Vaccination and infection | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_003443127 '''XM_003443127'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GACCCACACAGTGCCCATCT | ||
+ | * R:TCTCGGCTGTGGTGGTGAA | ||
+ | |align="center"| 140 | ||
+ | |align="center"| 59 | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | |||
+ | ===Molecular Types=== | ||
+ | * mRNA | ||
+ | |||
+ | ===Evaluation Methods=== | ||
+ | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
+ | * '''Ref-Finder method''' && [https://www.ncbi.nlm.nih.gov/pubmed/22290409 '''Related Reference'''] | ||
+ | ===Contact=== | ||
+ | *'''Name''': Kaiyu Wang | ||
+ | *'''Email''': kywangsicau@126.com | ||
+ | *'''Institution''': Department of Basic Veterinary, Sichuan Agricultural University, Wenjiang District Huimin Road No. 211, Chengdu 611130, China | ||
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=977892631141254526&as_sdt=2005&sciodt=0,5&hl=en '''11''' ](Based on Google Scholar [2017-09-01]) | ||
=='''References'''== | =='''References'''== | ||
Line 89: | Line 141: | ||
differentiation of a teleost fish, the Nile tilapia Oreochromis niloticus. Biol | differentiation of a teleost fish, the Nile tilapia Oreochromis niloticus. Biol | ||
Reprod. 2008 Feb;78(2):333-41. Epub 2007 Oct 17. PubMed PMID: 17942796. | Reprod. 2008 Feb;78(2):333-41. Epub 2007 Oct 17. PubMed PMID: 17942796. | ||
+ | </ref> | ||
+ | <ref name="ref3"> | ||
+ | Wang, Erlong, et al. "Evaluation and selection of appropriate reference genes for real-time quantitative PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus) during vaccination and infection." International journal of molecular sciences 16.5 (2015): 9998-10015. | ||
</ref> | </ref> | ||
</references> | </references> | ||
− | + | =='''Categories'''== | |
[[Category:Animals]] | [[Category:Animals]] | ||
[[Category:mRNA]] | [[Category:mRNA]] | ||
− | + | [[Category:ACT]] | |
[[Category:SYBR]] | [[Category:SYBR]] | ||
[[Category:18S rRNA]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:Ubiquitin]] | [[Category:18S rRNA]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:Ubiquitin]] | ||
[[Category:Different Tissues]] [[Category:Biotic Stress]] [[Category:Pathological conditions]] [[Category:Bacterial Infection]] | [[Category:Different Tissues]] [[Category:Biotic Stress]] [[Category:Pathological conditions]] [[Category:Bacterial Infection]] | ||
+ | |||
+ | [[Category:geNorm]] | ||
+ | |||
+ | [[Category:RefFinder]] |
Latest revision as of 04:29, 1 September 2017
Contents
Description
- Oreochromis niloticus is a species of tilapia, a cichlid fish native to Africa from Egypt south to east and central Africa, and as far west as Gambia. It is also native to Israel, and numerous introduced populations exist outside its natural range. As a gonochoristic teleost fish with an XX/XY sex-determining system, it provides an excellent model for studying gonadal sex differentiation because genetic all-females and all-males are available[1][2].
- Common Name: Nile tilapia
- NCBI Taxonomy
Different Tissues & Bacterial Infection
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
UBCE[1] | Ubiquitin-conjugating enzyme |
|
XM_003460024 |
|
130 | 59 | SYBR |
EF1A[1] | EF-1a mRNA for elongation factor 1a |
|
AB075952 |
|
250 | 59 | SYBR |
GADPH[1] | Glyceraldehyde-3-phosphate dehydrogenase |
|
JN381952 |
|
205 | 59 | SYBR |
18S rRNA[1] | 18S ribosomal RNA |
|
JF698683 |
|
111 | 59 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- Ref-Finder method && Related Reference
Contact
- Name: Hua Wen
- Email: wenhua.hb@163.com
- Institution: Key Laboratory of Freshwater Biodiversity Conservation and Utilization of Ministry of Agriculture, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China
Citation Statistics
Cited by 33 (Based on Google Scholar [2017-09-01])
Vaccination & Infection
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
EF1A[3] | Elongation factor 1 α |
|
AB075952 |
|
250 | 59 | SYBR |
ACTB[3] | β-actin |
|
XM_003443127 |
|
140 | 59 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- Ref-Finder method && Related Reference
Contact
- Name: Kaiyu Wang
- Email: kywangsicau@126.com
- Institution: Department of Basic Veterinary, Sichuan Agricultural University, Wenjiang District Huimin Road No. 211, Chengdu 611130, China
Citation Statistics
Cited by 11 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 1.3 1.4 Yang C G, Wang X L, Tian J, et al. Evaluation of reference genes for quantitative real-time RT-PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus)[J]. Gene, 2013, 527(1): 183-192.
- ↑ Ijiri S, Kaneko H, Kobayashi T, Wang DS, Sakai F, Paul-Prasanth B, Nakamura M, Nagahama Y. Sexual dimorphic expression of genes in gonads during early differentiation of a teleost fish, the Nile tilapia Oreochromis niloticus. Biol Reprod. 2008 Feb;78(2):333-41. Epub 2007 Oct 17. PubMed PMID: 17942796.
- ↑ 3.0 3.1 Wang, Erlong, et al. "Evaluation and selection of appropriate reference genes for real-time quantitative PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus) during vaccination and infection." International journal of molecular sciences 16.5 (2015): 9998-10015.