Difference between revisions of "Oreochromis niloticus"

Revision as of 02:59, 28 June 2017

Oreochromis niloticus is a species of tilapia, a cichlid fish native to Africa from Egypt south to east and central Africa, and as far west as Gambia. It is also native to Israel, and numerous introduced populations exist outside its natural range. As a gonochoristic teleost fish with an XX/XY sex-determining system, it provides an excellent model for studying gonadal sex differentiation because genetic all-females and all-males are available^[1]^[2].
Common Name: Nile tilapia
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
UBCE^[1]	Ubiquitin-conjugating enzyme	In the intestine, liver, brain, kidney, and spleen after S. iniae infection, and in the liver, kidney, and spleen after S. agalactiae infection	XM_003460024	F:CTCTCAAATCAATGCCACTTCC R:CCCTGGTGGAGGTTCCTTGT	130	59	SYBR
EF1A^[1]	EF-1a mRNA for elongation factor 1a	Heart and muscle after S. iniae or S. agalactiae infection	AB075952	F:GCACGCTCTGCTGGCCTTT R:GCGCTCAATCTTCCATCCC	250	59	SYBR
GADPH^[1]	Glyceraldehyde-3-phosphate dehydrogenase	In intestine and brain after S. agalactiae infection	JN381952	F:GATAATGGCAAACTTGTCGTCG R:ACATTGGAGCATCGGGTGAG	205	59	SYBR
18S rRNA^[1]	18S ribosomal RNA	Across the various tissues	JF698683	F:GGACACGGAAAGGATTGACAG R:GTTCGTTATCGGAATTAACCAGAC	111	59	SYBR

Name: Hua Wen
Email: wenhua.hb@163.com
Institution: Key Laboratory of Freshwater Biodiversity Conservation and Utilization of Ministry of Agriculture, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China

Cited by 32 (Based on Google Scholar [2017-06-16])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 Yang C G, Wang X L, Tian J, et al. Evaluation of reference genes for quantitative real-time RT-PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus)[J]. Gene, 2013, 527(1): 183-192.
↑ Ijiri S, Kaneko H, Kobayashi T, Wang DS, Sakai F, Paul-Prasanth B, Nakamura M, Nagahama Y. Sexual dimorphic expression of genes in gonads during early differentiation of a teleost fish, the Nile tilapia Oreochromis niloticus. Biol Reprod. 2008 Feb;78(2):333-41. Epub 2007 Oct 17. PubMed PMID: 17942796.

@@ Line 1: / Line 1: @@
 =='''Description'''==
 [[File:Oreochromis niloticus.png|right|200px]]
-*The Nile tilapia (Oreochromis niloticus) is a species of tilapia, a cichlid fish native to Africa from Egypt south to east and central Africa, and as far west as Gambia.
+*'''''Oreochromis niloticus''''' is a species of tilapia, a cichlid fish native to Africa from Egypt south to east and central Africa, and as far west as Gambia. It is also native to Israel, and numerous introduced populations exist outside its natural range. As a gonochoristic teleost fish with an XX/XY sex-determining system, it provides an excellent model for studying gonadal sex differentiation because genetic all-females and all-males are available<ref name="ref1"/><ref name="ref2"/>.
-*It is also native to Israel, and numerous introduced populations exist outside its natural range (e.g., Brazil).[2] It is also commercially known as mango fish, nilotica, or boulti.
-*The Nile tilapia, a gonochoristic teleost fish with an XX/XY sex-determining system, provides an excellent model for studying gonadal sex differentiation because genetic all-females and all-males are available<ref name="ref1"/><ref name="ref2"/>.
 * <font color=blue>'''Common Name:'''</font> '''Nile tilapia'''
 * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=8128 <font color=blue>'''NCBI Taxonomy'''</font>]