Oreochromis niloticus

Description

Gene Symbol	Gene Name	Application Scope	Accession Number	Primer	Size [bp]	Tm [℃]	Detection
UBCE^[1]	Ubiquitin-conjugating enzyme	in the intestine, liver, brain, kidney, and spleen after S. iniae infection, and in the liver, kidney, and spleen after S. agalactiae infection	XM_003460024	F:CTCTCAAATCAATGCCACTTCC R:CCCTGGTGGAGGTTCCTTGT	130	59	SYBR
EF1A^[1]	EF-1a mRNA for elongation factor 1a	heart and muscle after S. iniae or S. agalactiae infection	AB075952	F:GCACGCTCTGCTGGCCTTT R:GCGCTCAATCTTCCATCCC	250	59	SYBR
GADPH^[1]	Glyceraldehyde-3-phosphate dehydrogenase	in intestine and brain after S. agalactiae infection	JN381952	F:GATAATGGCAAACTTGTCGTCG R:ACATTGGAGCATCGGGTGAG	205	59	SYBR
18S rRNA^[1]	18S ribosomal RNA	across the various tissues	JF698683	F:GGACACGGAAAGGATTGACAG R:GTTCGTTATCGGAATTAACCAGAC	111	59	SYBR

Name: Hua Wen
Email: wenhua.hb@163.com
Institution: Key Laboratory of Freshwater Biodiversity Conservation and Utilization of Ministry of Agriculture, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China

↑ ^1.0 ^1.1 ^1.2 ^1.3 Yang C G, Wang X L, Tian J, et al. Evaluation of reference genes for quantitative real-time RT-PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus)[J]. Gene, 2013, 527(1): 183-192.