Oreochromis niloticus

Description

• The Nile tilapia (Oreochromis niloticus) is a species of tilapia, a cichlid fish native to Africa from Egypt south to east and central Africa, and as far west as Gambia.
• It is also native to Israel, and numerous introduced populations exist outside its natural range (e.g., Brazil).[2] It is also commercially known as mango fish, nilotica, or boulti.
• The Nile tilapia, a gonochoristic teleost fish with an XX/XY sex-determining system, provides an excellent model for studying gonadal sex differentiation because genetic all-females and all-males are available.

Different Tissues & Infection

Reference Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primer	Size [bp]	Tm [℃]	Detection
UBCE	Ubiquitin-conjugating enzyme	in the intestine, liver, brain, kidney, and spleen after S. iniae infection, and in the liver, kidney, and spleen after S. agalactiae infection	XM_003460024	F:CTCTCAAATCAATGCCACTTCC R:CCCTGGTGGAGGTTCCTTGT	130	59	SYBR
EF1A	EF-1a mRNA for elongation factor 1a	heart and muscle after S. iniae or S. agalactiae infection	AB075952	F:GCACGCTCTGCTGGCCTTT R:GCGCTCAATCTTCCATCCC	250	59	SYBR
GADPH	Glyceraldehyde-3-phosphate dehydrogenase	in intestine and brain after S. agalactiae infection	JN381952	F:GATAATGGCAAACTTGTCGTCG R:ACATTGGAGCATCGGGTGAG	205	59	SYBR
18S rRNA	18S ribosomal RNA	across the various tissues	JF698683	F:GGACACGGAAAGGATTGACAG R:GTTCGTTATCGGAATTAACCAGAC	111	59	SYBR

Moleculer Type

• mRNA

Evaluation Methods

• geNorm method && Related Reference
• Ref-Finder method && Related Reference

Contact

• Name: Hua Wen
• Email: wenhua.hb@163.com
• Institution: Key Laboratory of Freshwater Biodiversity Conservation and Utilization of Ministry of Agriculture, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China