Difference between revisions of "Oryctolagus cuniculus"
Jump to navigation
Jump to search
ICG Expert3 (talk | contribs) |
ICG Expert3 (talk | contribs) |
||
Line 23: | Line 23: | ||
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_002717921.1?report=genbank '''XM_002717921.1'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_002717921.1?report=genbank '''XM_002717921.1'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
− | * F: | + | * F:AACGTGGAACAGTCAGACC |
− | * R: | + | * R:AGTAATCTCGATCCCATTTC |
|align="center"| 157 | |align="center"| 157 | ||
|align="center"| 60 | |align="center"| 60 |
Revision as of 12:00, 20 June 2017
Contents
Description
- Rabbits are wildly spread in the world, it is small mammals in the family of the order Lagomorpha.The Lagomorpha family consists of eight different genera in the family classified as rabbits, including the European rabbit, cottontail rabbits, and the Amami rabbit. There are many other species of rabbit, and these, along with pikas and hares, make up the order Lagomorpha. Rabbits live in groups,underground burrows, or rabbit holes and feed by grazing on grass, forbs, and leafy weeds[1] [2] .
Cartilage Tissue Injury & Repair
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
B2M[1] | β-2-microglobulin |
|
XM_002717921.1 |
|
157 | 60 | SYBR |
18S rRNA[1] | 18S Ribosomal RNA |
|
NR_033238.1 |
|
167 | 60 | SYBR |
Moleculer Types
- mRNA
Evaluation Methods
Contact
- Name: Xiao-Xiang Peng
- Email: pxx74@sina.com
- Institute: Shandong Provincial Key Laboratory of Clinical Laboratory Diagnostics, Department of Medical Laboratory, Weifang Medical University, Shandong 261053, China
Citation Statistics
Cited by 12 (Based on Google Scholar [2017-06-16])
References
- ↑ 1.0 1.1 1.2 Peng X X, Zhao R L, Song W, et al. Selection of suitable reference genes for normalization of quantitative real-time PCR in cartilage tissue injury and repair in rabbits[J]. International journal of molecular sciences, 2012, 13(11): 14344-14355.
- ↑ Fedriani, J. M.; Palomares, F.; Delibes, M. (1999). "Niche relations among three sympatric Mediterranean carnivores" (PDF). Oecologia. 121: 138–148. doi:10.1007/s004420050915. JSTOR 4222449.