Difference between revisions of "Oryctolagus cuniculus"

From ICG
Jump to navigation Jump to search
Line 52: Line 52:
 
*'''Name''': Xiao-Xiang Peng
 
*'''Name''': Xiao-Xiang Peng
 
*'''Email''':  pxx74@sina.com
 
*'''Email''':  pxx74@sina.com
*'''Institute''':  Shandong Provincial Key Laboratory of Clinical Laboratory Diagnostics, Department of Medical Laboratory, Weifang Medical University, Shandong 261053, China
+
*'''Institution''':  Shandong Provincial Key Laboratory of Clinical Laboratory Diagnostics, Department of Medical Laboratory, Weifang Medical University, Shandong 261053, China
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
 
Cited by '''12''' (Based on Google Scholar [2017-06-16])
 
Cited by '''12''' (Based on Google Scholar [2017-06-16])

Revision as of 15:31, 22 June 2017

Description

Oryctolagus cuniculus-1.jpg
  • Rabbits are wildly spread in the world, it is small mammals in the family of the order Lagomorpha.The Lagomorpha family consists of eight different genera in the family classified as rabbits, including the European rabbit, cottontail rabbits, and the Amami rabbit. There are many other species of rabbit, and these, along with pikas and hares, make up the order Lagomorpha. Rabbits live in groups,underground burrows, or rabbit holes and feed by grazing on grass, forbs, and leafy weeds[1] [2] .

Cartilage Tissue Injury & Repair

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
B2M[1] β-2-microglobulin
  • Cartilage tissues
XM_002717921.1
  • F:AACGTGGAACAGTCAGACC
  • R:AGTAATCTCGATCCCATTTC
157 60 SYBR
18S rRNA[1] 18S Ribosomal RNA
  • Cartilage tissues
NR_033238.1
  • F:ATCAGATACCGTCGTAGTTC
  • R:TTCCGTCAATTCCTTTAAG
167 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiao-Xiang Peng
  • Email: pxx74@sina.com
  • Institution: Shandong Provincial Key Laboratory of Clinical Laboratory Diagnostics, Department of Medical Laboratory, Weifang Medical University, Shandong 261053, China

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Peng X X, Zhao R L, Song W, et al. Selection of suitable reference genes for normalization of quantitative real-time PCR in cartilage tissue injury and repair in rabbits[J]. International journal of molecular sciences, 2012, 13(11): 14344-14355.
  2. Fedriani, J. M.; Palomares, F.; Delibes, M. (1999). "Niche relations among three sympatric Mediterranean carnivores" (PDF). Oecologia. 121: 138–148. doi:10.1007/s004420050915. JSTOR 4222449.