Difference between revisions of "Oryza sativa"

From ICG
Jump to navigation Jump to search
(Created page with "__NOTITLE__ =='''Description'''== * Grapevine is one of the most cultivated fruit crop worldwide with ''Vitis vinifera'' being the species with the highest economical importan...")
 
Line 1: Line 1:
__NOTITLE__
 
 
=='''Description'''==
 
=='''Description'''==
* Grapevine is one of the most cultivated fruit crop worldwide with ''Vitis vinifera'' being the species with the highest economical importance due to the high quality standards of its berries.
+
[[File:Oraza_Sativa.jpg|right|272px|]]
=='''Downy Mildew Infection'''==
+
* Rice (''Oryza sativa L.'') is an ancient crop domesticated ca 9000 years ago and plays its significant roles as a staple food that feeds almost half of the human population. The two major subspecies, indica and japonica, are believed to have diverged several thousand years before domestication.
 +
* As a cereal, it is also a model plant that contributes to our understanding of the other major monocot crops like wheat and corn.
 +
 
 +
=='''''Abiotic Stress Conditions'''''==
 
===Reference Genes===
 
===Reference Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
Line 15: Line 17:
 
! Detection
 
! Detection
 
|-
 
|-
|align="center"| UBQ<ref name="ref1"/>
+
|align="center"| EP<ref name="ref1"/>
|align="center"| Ubiquitin-conjugating enzyme
+
|align="center"| Expressed protein
 
|
 
|
* Genotype effect
+
* diverse genotypes
* Biotic stress effect
+
* variation of developmental and environmental conditions
* Resistant cultivar Regent
+
|align="center"|  [http://rapdb.dna.affrc.go.jp/viewer/gbrowse_details/irgsp1?name=Os05g0182700'''LOC_Os05g08980''']  
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/EC922622 '''EC922622''']  
 
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:GAGGGTCGTCAGGATTTGGA
+
* F:TGAGCAAAATGGTGGAAAGC
* R:GCCCTGCACTTACCATCTTTAAG
+
* R:CAGTTGCAACCCCTGTATGA
|align="center"| 75
+
|align="center"| 97
 
|align="center"| 60
 
|align="center"| 60
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
|align="center"| EF1a<ref name="ref1"/>
+
|align="center"| HNR<ref name="ref1"/>
|align="center"| Elongation factor 1a
+
|align="center"| Heterogeneous nuclear ribonucleoprotein 27C
 
|
 
|
* Genotype effect
+
* diverse genotypes
* Susceptible cultivar trincadeira
+
* variation of developmental and environmental conditions
* Resistant cultivar regent
+
|align="center"|  [http://rapdb.dna.affrc.go.jp/viewer/gbrowse_details/irgsp1?name=Os01g0945800'''LOC_Os01g71770''']  
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/EC959059 '''EC959059''']  
 
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:GAACTGGGTGCTTGATAGGC
+
* F:GGCAGGTTCTGCAGTGGTAT
* R:ACCAAAATATCCGGAGTAAAAGA
+
* R:TAAGGTCGGTATCGCCAATC
|align="center"| 164
+
|align="center"| 95
 
|align="center"| 60
 
|align="center"| 60
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
|align="center"| GAPDH<ref name="ref1"/>
+
|align="center"| TBC<ref name="ref1"/>
|align="center"| glyceraldehyde-3-phosphate dehy-drogenase
+
|align="center"| TBC1 domain family member 22A
 
|
 
|
* Genotype effect
+
* diverse genotypes
* Resistant cultivar regent
+
* variation of developmental & environmental conditions
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/EF192466 '''EF192466''']  
+
|align="center"|  [http://rapdb.dna.affrc.go.jp/viewer/gbrowse_details/irgsp1?name=Os09g0515800'''LOC_Os09g34040 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:TCAAGGTCAAGGACTCTAACACC
+
* F:TGGTCATGTTCCTTCAGCAC
* R:CCAACAACGAACATAGGAGCA
+
* R:GACTTGGCGAGCTTTTGAAC
|align="center"| 226
+
|align="center"| 111
 
|align="center"| 60
 
|align="center"| 60
 +
|align="center"| SYBR
 +
|}
 +
 +
===Moleculer Type===
 +
* mRNA
 +
 +
===Evaluation Methods===
 +
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 +
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 +
 +
===Contact===
 +
*'''Name''': MAKSUP Sarunyaporn
 +
*'''Email''': Kanyaratt.sup@mahidol.ac.th
 +
*'''Institute''':  Department of Biotechnology, Faculty of Science, Mahidol University, Bangkok 10400, Thailand
 +
 +
=='''''Anther Development'''''==
 +
===Reference Genes===
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Gene Symbol 
 +
! Gene Name
 +
! style="width=25% font-size:9pt "|Application Scope
 +
! Accession Number
 +
! Primer
 +
! Size [bp]
 +
! Tm [℃]
 +
! Detection
 +
|-
 +
|align="center"| UPF3<ref name="ref2"/>
 +
|align="center"| Nonsense-mediated decay UPF3
 +
|
 +
*Anther Development
 +
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os04g35920.2 '''LOC_Os04g35920.2''']
 +
|nowrap style="font-size:9pt"|
 +
* F:TTCTGTCAGCAAGCAGATGG
 +
* R:GTTGGCAGAGGCTCTCTTTG
 +
|align="center"| 189
 +
|align="center"| 59
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| eIF4A-3<ref name="ref2"/>
 +
|align="center"| Eukaryotic initiation factor 4A-3
 +
|
 +
*Anther Development
 +
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os01g45190.1 '''LOC_Os01g45190.1''']
 +
|nowrap style="font-size:9pt"|
 +
* F:ATCCAGTTCGGATCCTTGTG
 +
* R:TGCAGAAAATGACAGCTTGG
 +
|align="center"| 150
 +
|align="center"| 59
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
|align="center"| SAND<ref name="ref1"/>
+
|align="center"| GAPDH<ref name="ref2"/>
|align="center"| SAND family protein
+
|align="center"| LOC_Os04g40950.1
 
|
 
|
* Susceptible cultivar trincadeira
+
*Anther Development
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CF405409 '''CF405409''']  
+
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os04g40950.1 '''LOC_Os01g45190.1''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:CAACATCCTTTACCCATTGACAGA
+
* F:AAGCCAGCATCCTATGATCAGATT
* R:GCATTTGATCCACTTGCAGATAAG
+
* R:CGTAACCCAGAATACCCTTGAGTTT
|align="center"| 76
+
|align="center"| 79
 +
|align="center"| 59
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| PPP6<ref name="ref2"/>
 +
|align="center"| Serine/threonine-protein phosphatase 6
 +
|
 +
*Anther Development
 +
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os01g49690.1 '''LOC_Os04g35920.2''']
 +
|nowrap style="font-size:9pt"|
 +
* F:TAATGGCACGGTTCTT
 +
* R:TCTTCAGGGTCACTCC
 +
|align="center"| 138
 +
|align="center"| 59
 +
|align="center"| SYBR
 +
|}
 +
===Moleculer Type===
 +
* mRNA
 +
===Evaluation Methods===
 +
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 +
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 +
===Contact===
 +
*'''Name''': Shaoqing Li
 +
*'''Email''': Shaoqingli@whu.edu.cn
 +
*'''Institution''': State Key Laboratory of Hybrid Rice, Key Laboratory for Research and Utilization of Heterosis in Indica Rice of Ministry of Agriculture, Engineering Research Center for Plant Biotechnology and Germplasm Utilization of Ministry of Education, College of Life Science, Wuhan University, Wuhan 430072, China
 +
 
 +
=='''''Seed Development'''''==
 +
===Reference Genes===
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Gene Symbol 
 +
! Gene Name
 +
! style="width=25% font-size:9pt "|Application Scope
 +
! Accession Number
 +
! Primer
 +
! Size [bp]
 +
! Tm [℃]
 +
! Detection
 +
|-
 +
|align="center"| ACT1<ref name="ref3"/>
 +
|align="center"| Actin 1
 +
|
 +
*Seeds atDifferent Developmental stages
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AK100267 '''AK100267''']
 +
|nowrap style="font-size:9pt"|
 +
* F:CTTCATAGGAATGGAAGCTGCGGGTA
 +
* R:CGACCACCTTGATCTTCATGCTGCTA
 +
|align="center"| 196
 
|align="center"| 60
 
|align="center"| 60
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| IF4A-3<ref name="ref3"/>
 +
|align="center"| Eukaryotic initiation factor 4A-3
 +
|
 +
*Seeds atDifferent Developmental stages
 +
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os01g45190.1 '''LOC_Os01g45190.1''']
 +
|nowrap style="font-size:9pt"|
 +
* F:ATCCAGTTCGGATCCTTGTG
 +
* R:TGCAGAAAATGACAGCTTGG
 +
|align="center"| 150
 +
|align="center"| 59
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
Line 71: Line 180:
 
===Moleculer Type===
 
===Moleculer Type===
 
* mRNA
 
* mRNA
 
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
 
 
 
===Contact===
 
===Contact===
*'''Name''': Filipa Monteiro
+
*'''Name''': Qiao-Quan Liu
*'''Email''': fimonteiro@fc.ul.pt
+
*'''Email''': qqliu@yzu.edu.cn
*'''Institute''': Plant Systems Biology Lab, Center of Biodiversity, Functional & Integrative Genomics (BioFIG), Science Faculty of Lisbon University, Lisboa, Portugal
+
*'''Institution''': Agricultural College, Yangzhou University, Yangzhou, Jiangsu 225009, China
  
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
Monteiro F, Sebastiana M, Pais M S, et al. Reference gene selection and validation for the early responses to downy mildew infection in susceptible and resistant Vitis vinifera cultivars[J]. PloS one, 2013, 8(9): e72998.
+
Maksup S, Supaibulwatana K, Selvaraj G. High-quality reference genes for quantifying the transcriptional responses of Oryza sativa L.(ssp. indica and japonica) to abiotic stress conditions[J]. Chinese Science Bulletin, 2013, 58(16): 1919-1930.
 +
</ref>
 +
<ref name="ref2">
 +
Ji Y, Tu P, Wang K, et al. Defining reference genes for quantitative real-time PCR analysis of anther development in rice[J]. Acta Biochim Biophys Sin, 2014, 46(4): 305-312.
 +
</ref>
 +
<ref name="ref3">
 +
Li Q F, Sun S S M, Yuan D Y, et al. Validation of candidate reference genes for the accurate normalization of real-time quantitative RT-PCR data in rice during seed development[J]. Plant Molecular Biology Reporter, 2010, 28(1): 49.
 
</ref>
 
</ref>
 
</references>
 
</references>

Revision as of 12:20, 15 June 2017

Description

Oraza Sativa.jpg
  • Rice (Oryza sativa L.) is an ancient crop domesticated ca 9000 years ago and plays its significant roles as a staple food that feeds almost half of the human population. The two major subspecies, indica and japonica, are believed to have diverged several thousand years before domestication.
  • As a cereal, it is also a model plant that contributes to our understanding of the other major monocot crops like wheat and corn.

Abiotic Stress Conditions

Reference Genes

Gene Symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
EP[1] Expressed protein
  • diverse genotypes
  • variation of developmental and environmental conditions
LOC_Os05g08980
  • F:TGAGCAAAATGGTGGAAAGC
  • R:CAGTTGCAACCCCTGTATGA
97 60 SYBR
HNR[1] Heterogeneous nuclear ribonucleoprotein 27C
  • diverse genotypes
  • variation of developmental and environmental conditions
LOC_Os01g71770
  • F:GGCAGGTTCTGCAGTGGTAT
  • R:TAAGGTCGGTATCGCCAATC
95 60 SYBR
TBC[1] TBC1 domain family member 22A
  • diverse genotypes
  • variation of developmental & environmental conditions
LOC_Os09g34040
  • F:TGGTCATGTTCCTTCAGCAC
  • R:GACTTGGCGAGCTTTTGAAC
111 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: MAKSUP Sarunyaporn
  • Email: Kanyaratt.sup@mahidol.ac.th
  • Institute: Department of Biotechnology, Faculty of Science, Mahidol University, Bangkok 10400, Thailand

Anther Development

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
UPF3[2] Nonsense-mediated decay UPF3
  • Anther Development
LOC_Os04g35920.2
  • F:TTCTGTCAGCAAGCAGATGG
  • R:GTTGGCAGAGGCTCTCTTTG
189 59 SYBR
eIF4A-3[2] Eukaryotic initiation factor 4A-3
  • Anther Development
LOC_Os01g45190.1
  • F:ATCCAGTTCGGATCCTTGTG
  • R:TGCAGAAAATGACAGCTTGG
150 59 SYBR
GAPDH[2] LOC_Os04g40950.1
  • Anther Development
LOC_Os01g45190.1
  • F:AAGCCAGCATCCTATGATCAGATT
  • R:CGTAACCCAGAATACCCTTGAGTTT
79 59 SYBR
PPP6[2] Serine/threonine-protein phosphatase 6
  • Anther Development
LOC_Os04g35920.2
  • F:TAATGGCACGGTTCTT
  • R:TCTTCAGGGTCACTCC
138 59 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Shaoqing Li
  • Email: Shaoqingli@whu.edu.cn
  • Institution: State Key Laboratory of Hybrid Rice, Key Laboratory for Research and Utilization of Heterosis in Indica Rice of Ministry of Agriculture, Engineering Research Center for Plant Biotechnology and Germplasm Utilization of Ministry of Education, College of Life Science, Wuhan University, Wuhan 430072, China

Seed Development

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACT1[3] Actin 1
  • Seeds atDifferent Developmental stages
AK100267
  • F:CTTCATAGGAATGGAAGCTGCGGGTA
  • R:CGACCACCTTGATCTTCATGCTGCTA
196 60 SYBR
IF4A-3[3] Eukaryotic initiation factor 4A-3
  • Seeds atDifferent Developmental stages
LOC_Os01g45190.1
  • F:ATCCAGTTCGGATCCTTGTG
  • R:TGCAGAAAATGACAGCTTGG
150 59 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Qiao-Quan Liu
  • Email: qqliu@yzu.edu.cn
  • Institution: Agricultural College, Yangzhou University, Yangzhou, Jiangsu 225009, China

References

  1. 1.0 1.1 1.2 Maksup S, Supaibulwatana K, Selvaraj G. High-quality reference genes for quantifying the transcriptional responses of Oryza sativa L.(ssp. indica and japonica) to abiotic stress conditions[J]. Chinese Science Bulletin, 2013, 58(16): 1919-1930.
  2. 2.0 2.1 2.2 2.3 Ji Y, Tu P, Wang K, et al. Defining reference genes for quantitative real-time PCR analysis of anther development in rice[J]. Acta Biochim Biophys Sin, 2014, 46(4): 305-312.
  3. 3.0 3.1 Li Q F, Sun S S M, Yuan D Y, et al. Validation of candidate reference genes for the accurate normalization of real-time quantitative RT-PCR data in rice during seed development[J]. Plant Molecular Biology Reporter, 2010, 28(1): 49.