Difference between revisions of "Oryza sativa"

From ICG
Jump to navigation Jump to search
 
(38 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:Oraza_Sativa.jpg|right|272px|]]
+
[[File:Oryza sativa.png|right|200px|link=Oryza sativa]]
* Rice (''Oryza sativa L.'') is an ancient crop domesticated ca 9000 years ago and plays its significant roles as a staple food that feeds almost half of the human population. The two major subspecies, indica and japonica, are believed to have diverged several thousand years before domestication.  
+
* '''''Oryza sativa''''' is an ancient crop domesticated ca 9000 years ago and plays significant roles as a staple food that feeds almost half of the world's population. It is also a monocot model that contributes to our understanding of other cereal crops like wheat and corn. The two major subspecies, indica and japonica, are believed to have diverged several thousand years before domestication.
* As a cereal, it is also a model plant that contributes to our understanding of the other major monocot crops like wheat and corn.
+
* <font color=blue>'''Common Name:'''</font> '''Asian rice'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4530 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Abiotic Stress Conditions'''''==
 
=='''''Abiotic Stress Conditions'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 12: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 20: Line 21:
 
|align="center"| Expressed protein
 
|align="center"| Expressed protein
 
|
 
|
* diverse genotypes
+
* Diverse genotypes
* variation of developmental and environmental conditions
+
* Variation of developmental and environmental conditions
 
|align="center"|  [http://rapdb.dna.affrc.go.jp/viewer/gbrowse_details/irgsp1?name=Os05g0182700'''LOC_Os05g08980''']  
 
|align="center"|  [http://rapdb.dna.affrc.go.jp/viewer/gbrowse_details/irgsp1?name=Os05g0182700'''LOC_Os05g08980''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 33: Line 34:
 
|align="center"| Heterogeneous nuclear ribonucleoprotein 27C
 
|align="center"| Heterogeneous nuclear ribonucleoprotein 27C
 
|
 
|
* diverse genotypes
+
* Diverse genotypes
* variation of developmental and environmental conditions
+
* Variation of developmental and environmental conditions
 
|align="center"|  [http://rapdb.dna.affrc.go.jp/viewer/gbrowse_details/irgsp1?name=Os01g0945800'''LOC_Os01g71770''']  
 
|align="center"|  [http://rapdb.dna.affrc.go.jp/viewer/gbrowse_details/irgsp1?name=Os01g0945800'''LOC_Os01g71770''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 46: Line 47:
 
|align="center"| TBC1 domain family member 22A
 
|align="center"| TBC1 domain family member 22A
 
|
 
|
* diverse genotypes
+
* Diverse genotypes
* variation of developmental & environmental conditions
+
* Variation of developmental & environmental conditions
 
|align="center"|  [http://rapdb.dna.affrc.go.jp/viewer/gbrowse_details/irgsp1?name=Os09g0515800'''LOC_Os09g34040 ''']  
 
|align="center"|  [http://rapdb.dna.affrc.go.jp/viewer/gbrowse_details/irgsp1?name=Os09g0515800'''LOC_Os09g34040 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 57: Line 58:
 
|}
 
|}
  
===Moleculer Type===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 67: Line 68:
 
*'''Name''': MAKSUP Sarunyaporn
 
*'''Name''': MAKSUP Sarunyaporn
 
*'''Email''': Kanyaratt.sup@mahidol.ac.th
 
*'''Email''': Kanyaratt.sup@mahidol.ac.th
*'''Institute''':  Department of Biotechnology, Faculty of Science, Mahidol University, Bangkok 10400, Thailand
+
*'''Institution''':  Department of Biotechnology, Faculty of Science, Mahidol University, Bangkok 10400, Thailand
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''16''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=6728856244356462115&as_sdt=2005&sciodt=0,5&hl=en'''15'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Anther Development'''''==
 
=='''''Anther Development'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 79: Line 81:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 87: Line 89:
 
|align="center"| Nonsense-mediated decay UPF3
 
|align="center"| Nonsense-mediated decay UPF3
 
|
 
|
*Anther Development
+
*Anther development
 
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os04g35920.2 '''LOC_Os04g35920.2''']  
 
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os04g35920.2 '''LOC_Os04g35920.2''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 99: Line 101:
 
|align="center"| Eukaryotic initiation factor 4A-3
 
|align="center"| Eukaryotic initiation factor 4A-3
 
|
 
|
*Anther Development
+
*Anther development
 
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os01g45190.1 '''LOC_Os01g45190.1''']  
 
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os01g45190.1 '''LOC_Os01g45190.1''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 109: Line 111:
 
|-
 
|-
 
|align="center"| GAPDH<ref name="ref2"/>
 
|align="center"| GAPDH<ref name="ref2"/>
|align="center"| LOC_Os04g40950.1
+
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
*Anther Development
+
*Anther development
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os04g40950.1 '''LOC_Os01g45190.1''']  
+
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os04g40950.1 '''LOC_Os04g40950.1''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:AAGCCAGCATCCTATGATCAGATT
 
* F:AAGCCAGCATCCTATGATCAGATT
Line 123: Line 125:
 
|align="center"| Serine/threonine-protein phosphatase 6
 
|align="center"| Serine/threonine-protein phosphatase 6
 
|
 
|
*Anther Development
+
*Anther development
 
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os01g49690.1 '''LOC_Os04g35920.2''']  
 
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os01g49690.1 '''LOC_Os04g35920.2''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 132: Line 134:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Moleculer Type===
+
 
 +
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 142: Line 146:
 
*'''Institution''': State Key Laboratory of Hybrid Rice, Key Laboratory for Research and Utilization of Heterosis in Indica Rice of Ministry of Agriculture, Engineering Research Center for Plant Biotechnology and Germplasm Utilization of Ministry of Education, College of Life Science, Wuhan University, Wuhan 430072, China
 
*'''Institution''': State Key Laboratory of Hybrid Rice, Key Laboratory for Research and Utilization of Heterosis in Indica Rice of Ministry of Agriculture, Engineering Research Center for Plant Biotechnology and Germplasm Utilization of Ministry of Education, College of Life Science, Wuhan University, Wuhan 430072, China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''6''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=2199336722057269838&as_sdt=2005&sciodt=0,5&hl=en'''6'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Seed Development'''''==
 
=='''''Seed Development'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 152: Line 156:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 160: Line 164:
 
|align="center"| Actin 1
 
|align="center"| Actin 1
 
|
 
|
*Seeds atDifferent Developmental stages
+
*Seeds at different developmental stages
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AK100267 '''AK100267''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AK100267 '''AK100267''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 172: Line 176:
 
|align="center"| Eukaryotic initiation factor 4A-3
 
|align="center"| Eukaryotic initiation factor 4A-3
 
|
 
|
*Seeds atDifferent Developmental stages
+
*Seeds at different developmental stages
 
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os01g45190.1 '''LOC_Os01g45190.1''']  
 
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os01g45190.1 '''LOC_Os01g45190.1''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 182: Line 186:
 
|}
 
|}
  
===Moleculer Type===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 190: Line 195:
 
*'''Email''': qqliu@yzu.edu.cn
 
*'''Email''': qqliu@yzu.edu.cn
 
*'''Institution''': Agricultural College, Yangzhou University, Yangzhou, Jiangsu 225009, China
 
*'''Institution''': Agricultural College, Yangzhou University, Yangzhou, Jiangsu 225009, China
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=5593952054225172892&as_sdt=2005&sciodt=0,5&hl=en'''99'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 203: Line 210:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 +
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:ACT]][[Category:eIF]][[Category:eIF]][[Category:EP]][[Category:GAPDH]][[Category:HNR]][[Category:SPP]] [[Category:TBC]][[Category:UPF3]][[Category:Anther Development]][[Category:Abiotic Stress]][[Category:Seed Development]][[Category:geNorm]][[Category:NormFinder]]

Latest revision as of 07:13, 1 September 2017

Description

Oryza sativa.png
  • Oryza sativa is an ancient crop domesticated ca 9000 years ago and plays significant roles as a staple food that feeds almost half of the world's population. It is also a monocot model that contributes to our understanding of other cereal crops like wheat and corn. The two major subspecies, indica and japonica, are believed to have diverged several thousand years before domestication.
  • Common Name: Asian rice
  • NCBI Taxonomy

Abiotic Stress Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EP[1] Expressed protein
  • Diverse genotypes
  • Variation of developmental and environmental conditions
LOC_Os05g08980
  • F:TGAGCAAAATGGTGGAAAGC
  • R:CAGTTGCAACCCCTGTATGA
97 60 SYBR
HNR[1] Heterogeneous nuclear ribonucleoprotein 27C
  • Diverse genotypes
  • Variation of developmental and environmental conditions
LOC_Os01g71770
  • F:GGCAGGTTCTGCAGTGGTAT
  • R:TAAGGTCGGTATCGCCAATC
95 60 SYBR
TBC[1] TBC1 domain family member 22A
  • Diverse genotypes
  • Variation of developmental & environmental conditions
LOC_Os09g34040
  • F:TGGTCATGTTCCTTCAGCAC
  • R:GACTTGGCGAGCTTTTGAAC
111 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: MAKSUP Sarunyaporn
  • Email: Kanyaratt.sup@mahidol.ac.th
  • Institution: Department of Biotechnology, Faculty of Science, Mahidol University, Bangkok 10400, Thailand

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-09-01])

Anther Development

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UPF3[2] Nonsense-mediated decay UPF3
  • Anther development
LOC_Os04g35920.2
  • F:TTCTGTCAGCAAGCAGATGG
  • R:GTTGGCAGAGGCTCTCTTTG
189 59 SYBR
eIF4A-3[2] Eukaryotic initiation factor 4A-3
  • Anther development
LOC_Os01g45190.1
  • F:ATCCAGTTCGGATCCTTGTG
  • R:TGCAGAAAATGACAGCTTGG
150 59 SYBR
GAPDH[2] Glyceraldehyde-3-phosphate dehydrogenase
  • Anther development
LOC_Os04g40950.1
  • F:AAGCCAGCATCCTATGATCAGATT
  • R:CGTAACCCAGAATACCCTTGAGTTT
79 59 SYBR
PPP6[2] Serine/threonine-protein phosphatase 6
  • Anther development
LOC_Os04g35920.2
  • F:TAATGGCACGGTTCTT
  • R:TCTTCAGGGTCACTCC
138 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Shaoqing Li
  • Email: Shaoqingli@whu.edu.cn
  • Institution: State Key Laboratory of Hybrid Rice, Key Laboratory for Research and Utilization of Heterosis in Indica Rice of Ministry of Agriculture, Engineering Research Center for Plant Biotechnology and Germplasm Utilization of Ministry of Education, College of Life Science, Wuhan University, Wuhan 430072, China

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

Seed Development

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT1[3] Actin 1
  • Seeds at different developmental stages
AK100267
  • F:CTTCATAGGAATGGAAGCTGCGGGTA
  • R:CGACCACCTTGATCTTCATGCTGCTA
196 60 SYBR
IF4A-3[3] Eukaryotic initiation factor 4A-3
  • Seeds at different developmental stages
LOC_Os01g45190.1
  • F:ATCCAGTTCGGATCCTTGTG
  • R:TGCAGAAAATGACAGCTTGG
150 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Qiao-Quan Liu
  • Email: qqliu@yzu.edu.cn
  • Institution: Agricultural College, Yangzhou University, Yangzhou, Jiangsu 225009, China

Citation Statistics

Cited by 99 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Maksup S, Supaibulwatana K, Selvaraj G. High-quality reference genes for quantifying the transcriptional responses of Oryza sativa L.(ssp. indica and japonica) to abiotic stress conditions[J]. Chinese Science Bulletin, 2013, 58(16): 1919-1930.
  2. 2.0 2.1 2.2 2.3 Ji Y, Tu P, Wang K, et al. Defining reference genes for quantitative real-time PCR analysis of anther development in rice[J]. Acta Biochim Biophys Sin, 2014, 46(4): 305-312.
  3. 3.0 3.1 Li Q F, Sun S S M, Yuan D Y, et al. Validation of candidate reference genes for the accurate normalization of real-time quantitative RT-PCR data in rice during seed development[J]. Plant Molecular Biology Reporter, 2010, 28(1): 49.

Categories