Difference between revisions of "Oryza sativa"

From ICG
Jump to navigation Jump to search
 
(6 intermediate revisions by 2 users not shown)
Line 58: Line 58:
 
|}
 
|}
  
−
===Molecular Type===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 71: Line 71:
  
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''15''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=6728856244356462115&as_sdt=2005&sciodt=0,5&hl=en'''15'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Anther Development'''''==
 
=='''''Anther Development'''''==
Line 114: Line 114:
 
|
 
|
 
*Anther development
 
*Anther development
−
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os04g40950.1 '''LOC_Os01g45190.1''']  
+
|align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os04g40950.1 '''LOC_Os04g40950.1''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:AAGCCAGCATCCTATGATCAGATT
 
* F:AAGCCAGCATCCTATGATCAGATT
Line 135: Line 135:
 
|}
 
|}
  
−
===Molecular Type===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 145: Line 146:
 
*'''Institution''': State Key Laboratory of Hybrid Rice, Key Laboratory for Research and Utilization of Heterosis in Indica Rice of Ministry of Agriculture, Engineering Research Center for Plant Biotechnology and Germplasm Utilization of Ministry of Education, College of Life Science, Wuhan University, Wuhan 430072, China
 
*'''Institution''': State Key Laboratory of Hybrid Rice, Key Laboratory for Research and Utilization of Heterosis in Indica Rice of Ministry of Agriculture, Engineering Research Center for Plant Biotechnology and Germplasm Utilization of Ministry of Education, College of Life Science, Wuhan University, Wuhan 430072, China
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''6''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=2199336722057269838&as_sdt=2005&sciodt=0,5&hl=en'''6'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Seed Development'''''==
 
=='''''Seed Development'''''==
Line 185: Line 186:
 
|}
 
|}
  
−
===Molecular Type===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 194: Line 196:
 
*'''Institution''': Agricultural College, Yangzhou University, Yangzhou, Jiangsu 225009, China
 
*'''Institution''': Agricultural College, Yangzhou University, Yangzhou, Jiangsu 225009, China
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''98''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=5593952054225172892&as_sdt=2005&sciodt=0,5&hl=en'''99'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==

Latest revision as of 07:13, 1 September 2017

Description

Oryza sativa.png
  • Oryza sativa is an ancient crop domesticated ca 9000 years ago and plays significant roles as a staple food that feeds almost half of the world's population. It is also a monocot model that contributes to our understanding of other cereal crops like wheat and corn. The two major subspecies, indica and japonica, are believed to have diverged several thousand years before domestication.
  • Common Name: Asian rice
  • NCBI Taxonomy

Abiotic Stress Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
EP[1] Expressed protein
  • Diverse genotypes
  • Variation of developmental and environmental conditions
 LOC_Os05g08980
  • F:TGAGCAAAATGGTGGAAAGC
  • R:CAGTTGCAACCCCTGTATGA
 97 60 SYBR
HNR[1] Heterogeneous nuclear ribonucleoprotein 27C
  • Diverse genotypes
  • Variation of developmental and environmental conditions
 LOC_Os01g71770
  • F:GGCAGGTTCTGCAGTGGTAT
  • R:TAAGGTCGGTATCGCCAATC
 95 60 SYBR
TBC[1] TBC1 domain family member 22A
  • Diverse genotypes
  • Variation of developmental & environmental conditions
 LOC_Os09g34040
  • F:TGGTCATGTTCCTTCAGCAC
  • R:GACTTGGCGAGCTTTTGAAC
 111 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: MAKSUP Sarunyaporn
  • Email: Kanyaratt.sup@mahidol.ac.th
  • Institution: Department of Biotechnology, Faculty of Science, Mahidol University, Bangkok 10400, Thailand

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-09-01])

Anther Development

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
UPF3[2] Nonsense-mediated decay UPF3
  • Anther development
 LOC_Os04g35920.2
  • F:TTCTGTCAGCAAGCAGATGG
  • R:GTTGGCAGAGGCTCTCTTTG
 189 59 SYBR
eIF4A-3[2] Eukaryotic initiation factor 4A-3
  • Anther development
 LOC_Os01g45190.1
  • F:ATCCAGTTCGGATCCTTGTG
  • R:TGCAGAAAATGACAGCTTGG
 150 59 SYBR
GAPDH[2] Glyceraldehyde-3-phosphate dehydrogenase
  • Anther development
 LOC_Os04g40950.1
  • F:AAGCCAGCATCCTATGATCAGATT
  • R:CGTAACCCAGAATACCCTTGAGTTT
 79 59 SYBR
PPP6[2] Serine/threonine-protein phosphatase 6
  • Anther development
 LOC_Os04g35920.2
  • F:TAATGGCACGGTTCTT
  • R:TCTTCAGGGTCACTCC
 138 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Shaoqing Li
  • Email: Shaoqingli@whu.edu.cn
  • Institution: State Key Laboratory of Hybrid Rice, Key Laboratory for Research and Utilization of Heterosis in Indica Rice of Ministry of Agriculture, Engineering Research Center for Plant Biotechnology and Germplasm Utilization of Ministry of Education, College of Life Science, Wuhan University, Wuhan 430072, China

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

Seed Development

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
ACT1[3] Actin 1
  • Seeds at different developmental stages
 AK100267
  • F:CTTCATAGGAATGGAAGCTGCGGGTA
  • R:CGACCACCTTGATCTTCATGCTGCTA
 196 60 SYBR
IF4A-3[3] Eukaryotic initiation factor 4A-3
  • Seeds at different developmental stages
 LOC_Os01g45190.1
  • F:ATCCAGTTCGGATCCTTGTG
  • R:TGCAGAAAATGACAGCTTGG
 150 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Qiao-Quan Liu
  • Email: qqliu@yzu.edu.cn
  • Institution: Agricultural College, Yangzhou University, Yangzhou, Jiangsu 225009, China

Citation Statistics

Cited by 99 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 Maksup S, Supaibulwatana K, Selvaraj G. High-quality reference genes for quantifying the transcriptional responses of Oryza sativa L.(ssp. indica and japonica) to abiotic stress conditions[J]. Chinese Science Bulletin, 2013, 58(16): 1919-1930.
  2. ↑ 2.0 2.1 2.2 2.3 Ji Y, Tu P, Wang K, et al. Defining reference genes for quantitative real-time PCR analysis of anther development in rice[J]. Acta Biochim Biophys Sin, 2014, 46(4): 305-312.
  3. ↑ 3.0 3.1 Li Q F, Sun S S M, Yuan D Y, et al. Validation of candidate reference genes for the accurate normalization of real-time quantitative RT-PCR data in rice during seed development[J]. Plant Molecular Biology Reporter, 2010, 28(1): 49.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Oryza_sativa&oldid=8739"