Difference between revisions of "Oryza sativa"
Jump to navigation
Jump to search
Yang Zhang (talk | contribs) |
|||
| Line 114: | Line 114: | ||
| | | | ||
*Anther development | *Anther development | ||
| − | |align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os04g40950.1 ''' | + | |align="center"| [http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?orf=LOC_Os04g40950.1 '''LOC_Os04g40950.1'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:AAGCCAGCATCCTATGATCAGATT | * F:AAGCCAGCATCCTATGATCAGATT | ||
Revision as of 10:51, 11 August 2017
Contents
Description
- Oryza sativa is an ancient crop domesticated ca 9000 years ago and plays significant roles as a staple food that feeds almost half of the world's population. It is also a monocot model that contributes to our understanding of other cereal crops like wheat and corn. The two major subspecies, indica and japonica, are believed to have diverged several thousand years before domestication.
- Common Name: Asian rice
- NCBI Taxonomy
Abiotic Stress Conditions
Internal Control Genes
| Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
|---|---|---|---|---|---|---|---|
| EP[1] | Expressed protein |
|
LOC_Os05g08980 |
|
97 | 60 | SYBR |
| HNR[1] | Heterogeneous nuclear ribonucleoprotein 27C |
|
LOC_Os01g71770 |
|
95 | 60 | SYBR |
| TBC[1] | TBC1 domain family member 22A |
|
LOC_Os09g34040 |
|
111 | 60 | SYBR |
Molecular Type
- mRNA
Evaluation Methods
Contact
- Name: MAKSUP Sarunyaporn
- Email: Kanyaratt.sup@mahidol.ac.th
- Institution: Department of Biotechnology, Faculty of Science, Mahidol University, Bangkok 10400, Thailand
Citation Statistics
Cited by 15 (Based on Google Scholar [2017-08-10])
Anther Development
Internal Control Genes
| Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
|---|---|---|---|---|---|---|---|
| UPF3[2] | Nonsense-mediated decay UPF3 |
|
LOC_Os04g35920.2 |
|
189 | 59 | SYBR |
| eIF4A-3[2] | Eukaryotic initiation factor 4A-3 |
|
LOC_Os01g45190.1 |
|
150 | 59 | SYBR |
| GAPDH[2] | Glyceraldehyde-3-phosphate dehydrogenase |
|
LOC_Os04g40950.1 |
|
79 | 59 | SYBR |
| PPP6[2] | Serine/threonine-protein phosphatase 6 |
|
LOC_Os04g35920.2 |
|
138 | 59 | SYBR |
Molecular Type
- mRNA
Evaluation Methods
Contact
- Name: Shaoqing Li
- Email: Shaoqingli@whu.edu.cn
- Institution: State Key Laboratory of Hybrid Rice, Key Laboratory for Research and Utilization of Heterosis in Indica Rice of Ministry of Agriculture, Engineering Research Center for Plant Biotechnology and Germplasm Utilization of Ministry of Education, College of Life Science, Wuhan University, Wuhan 430072, China
Citation Statistics
Cited by 6 (Based on Google Scholar [2017-08-10])
Seed Development
Internal Control Genes
| Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
|---|---|---|---|---|---|---|---|
| ACT1[3] | Actin 1 |
|
AK100267 |
|
196 | 60 | SYBR |
| IF4A-3[3] | Eukaryotic initiation factor 4A-3 |
|
LOC_Os01g45190.1 |
|
150 | 59 | SYBR |
Molecular Type
- mRNA
Evaluation Methods
Contact
- Name: Qiao-Quan Liu
- Email: qqliu@yzu.edu.cn
- Institution: Agricultural College, Yangzhou University, Yangzhou, Jiangsu 225009, China
Citation Statistics
Cited by 98 (Based on Google Scholar [2017-08-10])
References
- ↑ 1.0 1.1 1.2 Maksup S, Supaibulwatana K, Selvaraj G. High-quality reference genes for quantifying the transcriptional responses of Oryza sativa L.(ssp. indica and japonica) to abiotic stress conditions[J]. Chinese Science Bulletin, 2013, 58(16): 1919-1930.
- ↑ 2.0 2.1 2.2 2.3 Ji Y, Tu P, Wang K, et al. Defining reference genes for quantitative real-time PCR analysis of anther development in rice[J]. Acta Biochim Biophys Sin, 2014, 46(4): 305-312.
- ↑ 3.0 3.1 Li Q F, Sun S S M, Yuan D Y, et al. Validation of candidate reference genes for the accurate normalization of real-time quantitative RT-PCR data in rice during seed development[J]. Plant Molecular Biology Reporter, 2010, 28(1): 49.
