Difference between revisions of "Ovis aries"

From ICG
Jump to navigation Jump to search
Line 58: Line 58:
  
 
[[Category:Animals]]
 
[[Category:Animals]]
 +
[[Category:mRNA]] 
 +
[[Category:SYBR]]

Revision as of 07:40, 19 June 2017

Description

REFqPCR2016019-1.jpg
  • The skeleton of sheep (Ovis aries) and goat (Capra hircus) is very similar as they are taxonomically closely species, so even small differences in either macroscopical or microscopical fields are worth exploring. One of the many peaceful creatures on the Ark, Ovis will not attempt to attack in any way, much preferring to flee to safety. The Ovis otherwise ignore other creatures and players entirely. When attacking on foot, be cautious of placement. Ovis will clamber up steep rocks with ease and leave you without easy access.
  • The sheep (Ovis aries) is a quadrupedal, ruminant mammal typically kept as livestock. Like all ruminants, sheep are members of the order Artiodactyla, the even-toed ungulates. Although the name "sheep" applies to many species in the genus Ovis, in everyday usage it almost always refers to Ovis aries. Numbering a little over one billion, domestic sheep are also the most numerous species of sheep. An adult female sheep is referred to as a ewe, an intact male as a ram or occasionally a tup, a castrated male as a wether, and a younger sheep as a lamb. [1] [2].

Preterm Lamb Model

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[1] glyceraldehyde-3-phosphate dehydrogenase (GAPDH), mRNA
  • Lung injury in preterm lamb model
NM_001190390
  • F:GGCCTCCAAGGAGTAAGGTC
  • R:GGCCTCCAAGGAGTAAGGTC
60 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Prue M. Pereira-Fantini
  • Email: prue.pereira@mcri.edu.au
  • Institution: Neonatal Research Group, Murdoch Childrens Research Institute, Parkville, Australia.

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 Pereira-Fantini PM, Rajapaksa AE, Oakley R, Tingay DG (2016) Selection of Reference Genes for Gene Expression Studies related to lung injury in a preterm lamb model. Sci Rep 6, 26476.
  2. Zedda M, Palombo MR, Brits D, et al. (2016) Differences in femoral morphology between sheep (Ovis aries) and goat (Capra hircus): macroscopic and microscopic observations. Zoomorphology 136, 145-158.