Difference between revisions of "Oxytropis ochrocephala"

From ICG
Jump to navigation Jump to search
Line 82: Line 82:
  
 
[[Category:Plants]]
 
[[Category:Plants]]
 +
[[Category:mRNA]] 
 +
[[Category:SYBR]]

Revision as of 07:45, 19 June 2017

Description

REFqPCR2015013-1.jpg
  • Oxytropis ochrocephala Bunge, an indigenous locoweed species in China, poses great threats to livestock on grasslands. There is a need for further genetic study in the plants per se, for understanding the basis of its acclimation mechanism in various unfavorable environmental conditions and to implement effective control measures.
  • Oxytropis ochrocephala Bunge (Fabaceae), a perennial grass species, grows aggressively on the grassland of northwestern China. It is the most widespread locoweed (the collective name for toxic Oxytropis and Astragalus species) in China. Locoweeds contain an indolizidine alkaloid swainsonine, an α-mannosidase inhibitor which causes over-accumulation of mannose rich oligosaccharide in the lysosomes and impairs the neural system of livestock, which has long been recognized as the principle for intoxication in animals.
  • Locoweeds (Astragalus and Oxytropis spp. that contain the toxic alkaloid swainsonine) cause widespread poisoning of livestock on western rangelands. There are 354 species of Astragalus and 22 species of Oxytropis in the US and Canada. Recently, a fungal endophyte, Embellisia spp., was isolated from Astragalus and Oxytropis spp. and shown to produce swainsonine. We conducted a survey of the major locoweeds from areas where locoweed poisoning has occurred to verify the presence of the endophyte and to relate endophyte infection with swainsonine concentrations. [1] [2].

Abiotic Stress Treatments

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
HIS[1] histone H3 mRNA
  • Universal reference gene
KR733680
  • F:ATGGGCTTGGTGCTGTTA
  • R:ATGGGCTTGGTGCTGTTA
95 60 SYBR
ACT7[1] actin-7
  • Universal reference gene
KR822227
  • F:CTCCACCAGAGAGAAAGTACAGT
  • R:CTCCACCAGAGAGAAAGTACAGT
266 60 SYBR
ACT101[1] Actin 101
  • Universal reference gene
KR822225
  • F:GGGTGAATATGATGAATCTGG
  • R:GGGTGAATATGATGAATCTGG
232 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yahui Wei
  • Email: weiyahui@nwu.edu.cn
  • Institution: Key Laboratory of Resource Biology and Biotechnology in Western China, Department of Life Science, Northwest University, Xi’an, China

Citation Statistics

Cited by 103 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 Ralphs MH, Creamer R, Baucom D, et al. (2008) Relationship between the endophyte Embellisia spp. and the toxic alkaloid swainsonine in major locoweed species (Astragalus and Oxytropis). J Chem Ecol 34, 32-38.
  2. Zhuang H, Fu Y, He W, Wang L, Wei Y (2015) Selection of appropriate reference genes for quantitative real-time PCR in Oxytropis ochrocephala Bunge using transcriptome datasets under abiotic stress treatments. Front Plant Sci 6, 475.