Oxytropis ochrocephala

Description

Oxytropis ochrocephala Bunge is a perennial grass species. It is the most widespread locoweed that grows aggressively on the grassland in China and poses great threats to livestock. Locoweeds contain an indolizidine alkaloid swainsonine, an α-mannosidase inhibitor which causes over-accumulation of mannose rich oligosaccharide in the lysosomes and impairs the neural system of livestock, which has long been recognized as the principle for intoxication in animals. There is a need for further genetic study in the plants for understanding the basis of its acclimation mechanism in various unfavorable environmental conditions and to implement effective control measures^[1] ^[2].
Common Name: Huang hua ji dou
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
HIS^[1]	Histone H3	Drought, cold and salt stress Seedlings	KR733680	F:ATGGGCTTGGTGCTGTTA R:CCTTCATCAGACTAGCAGTAAAC	95	60	SYBR
ACT7^[1]	Actin-7	Drought, cold and salt stress Seedlings	KR822227	F:CTCCACCAGAGAGAAAGTACAGT R:CCCAGAATATACCCTCCGAT	266	60	SYBR
ACT101^[1]	Actin 101	Drought, cold and salt stress Seedlings	KR822225	F:GGGTGAATATGATGAATCTGG R:GTCTGGCTTTCAAGGACATAA	232	60	SYBR

Name: Yahui Wei
Email: weiyahui@nwu.edu.cn
Institution: Key Laboratory of Resource Biology and Biotechnology in Western China, Department of Life Science, Northwest University, Xi’an, China

Cited by 22 (Based on Google Scholar [2017-06-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Zhuang H, Fu Y, He W, Wang L, Wei Y (2015) Selection of appropriate reference genes for quantitative real-time PCR in Oxytropis ochrocephala Bunge using transcriptome datasets under abiotic stress treatments. Front Plant Sci 6, 475.
↑ Ralphs MH, Creamer R, Baucom D, et al. (2008) Relationship between the endophyte Embellisia spp. and the toxic alkaloid swainsonine in major locoweed species (Astragalus and Oxytropis). J Chem Ecol 34, 32-38.