Difference between revisions of "Paeonia suffruticosa"

From ICG
Jump to navigation Jump to search
 
(14 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2017007-1.jpg|right|327px|]]
+
[[File:Paeonia suffruticosa.png|right|200px|link=Paeonia suffruticosa]]
 +
 
 +
*'''''Paeonia suffruticosa''''' is a perennial plant indigenous to China known for its elegant and vibrantly colorful flowers. The flowers are brightly colored, the magnificence has the reputation of 'the king of flowers'. In the cultivated type, it is mainly based on the color of the flowers, which can be divided into hundreds of varieties. The papery flamboyant blooms and interesting foliage of tree peonies gives the impression that the plants are delicate. Tree peonies are long-lived deciduous shrubs provided they are grown in a suitable spot.<ref name="ref1"/> <ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> ''' Mu dan'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=45171 <font color=blue>'''NCBI Taxonomy'''</font>]
  
* Tree peony (Paeonia suffruticosa) is a perennial plant indigenous to China known for its elegant and vibrantly colorful flowers.
 
* The peony is the peony family, the peony plant, is the perennial deciduous small shrub. The flowers are brightly colored, the jade smile is fragrant, the wind is handsome, the magnificence, has the reputation of "the king of flowers".
 
* In the cultivated type, it is mainly based on the color of the flowers, which can be divided into hundreds of varieties. "Peony variety, colour and lustre are also more, with yellow, green, pinkish red, scarlet and vermillion after taste, yellow, green for you especially. Peony's big and sweet, so it is called" amusement ".
 
*  The papery flamboyant blooms and interesting foliage of tree peonies gives the impression that the plants are delicate. Thankfully, the complete opposite is true. Tree peonies are long-lived, hardy shrubs provided they are grown in a suitable spot. The common name is misleading as they are not trees but deciduous shrubs.<ref name="ref1"/> <ref name="ref2"/>.
 
 
=='''''Flower Development & Different Cultivars'''''==
 
=='''''Flower Development & Different Cultivars'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 14: Line 14:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 26: Line 26:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CTGGAGTTTTCACCGACAAGG
 
* F:CTGGAGTTTTCACCGACAAGG
* R:CTGGAGTTTTCACCGACAAGG
+
* R:CCAATGGGGCAAGACAGTTAG
 
|align="center"|  186  
 
|align="center"|  186  
 
|align="center"| 60
 
|align="center"| 60
Line 38: Line 38:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TACCCAAACAGCCCTCCAAC
 
* F:TACCCAAACAGCCCTCCAAC
* R:TACCCAAACAGCCCTCCAAC
+
* R:AGCAGCTTCAATGTTTGCCG
 
|align="center"|  234  
 
|align="center"|  234  
 
|align="center"| 59
 
|align="center"| 59
Line 50: Line 50:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TCCTGGGCATCGTGACTTTA
 
* F:TCCTGGGCATCGTGACTTTA
* R:TCCTGGGCATCGTGACTTTA
+
* R:TTCATCATACCGAGCCTTTG
 
|align="center"|  232  
 
|align="center"|  232  
 
|align="center"| 60
 
|align="center"| 60
Line 56: Line 56:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 
===Evaluation Methods===  
 
===Evaluation Methods===  
Line 69: Line 69:
 
*'''Institution''': Ministry of Education Key Laboratory for Biodiversity Science and Ecological Engineering, Fudan University, Shanghai, China
 
*'''Institution''': Ministry of Education Key Laboratory for Biodiversity Science and Ecological Engineering, Fudan University, Shanghai, China
  
==Citation Statistics==
+
===Citation Statistics===
Cited by '''5''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=2714408666562395007&as_sdt=2005&sciodt=0,5&hl=en'''6'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 82: Line 82:
 
</references>
 
</references>
  
[[Category:Plants]]
+
=='''Categories'''==
[[Category:mRNA]] 
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:EF1α]][[Category:GAPDH]][[Category:Ubiquitin]][[Category:Flower Development]][[Category:Different Cultivars]]
[[Category:SYBR]]
+
[[Category:geNorm]][[Category:NormFinder]][[Category:BestKeeper]][[Category:RefFinder]]

Latest revision as of 07:14, 1 September 2017

Description

Paeonia suffruticosa.png
  • Paeonia suffruticosa is a perennial plant indigenous to China known for its elegant and vibrantly colorful flowers. The flowers are brightly colored, the magnificence has the reputation of 'the king of flowers'. In the cultivated type, it is mainly based on the color of the flowers, which can be divided into hundreds of varieties. The papery flamboyant blooms and interesting foliage of tree peonies gives the impression that the plants are delicate. Tree peonies are long-lived deciduous shrubs provided they are grown in a suitable spot.[1] [2].
  • Common Name: Mu dan
  • NCBI Taxonomy

Flower Development & Different Cultivars

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • 'Feng Dan' & 'Xi Shi' cultivars
KU853028
  • F:CTGGAGTTTTCACCGACAAGG
  • R:CCAATGGGGCAAGACAGTTAG
186 60 SYBR
UBC[1] Ubiquitin conjugating enzyme
  • 'Feng Dan' &'Xi Shi' cultivars
KU853027
  • F:TACCCAAACAGCCCTCCAAC
  • R:AGCAGCTTCAATGTTTGCCG
234 59 SYBR
EF-1α[1] Elongation factor 1 alpha
  • In 'Que Hao' cultivar
KU853032
  • F:TCCTGGGCATCGTGACTTTA
  • R:TTCATCATACCGAGCCTTTG
232 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ji Yang
  • Email: jiyang@fudan.edu.cn
  • Institution: Ministry of Education Key Laboratory for Biodiversity Science and Ecological Engineering, Fudan University, Shanghai, China

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Li J, Han J, Hu Y, Yang J (2016) Selection of Reference Genes for Quantitative Real-Time PCR during Flower Development in Tree Peony (Paeonia suffruticosa Andr.). Front Plant Sci 7, 516.
  2. Sang T, Crawford DJ, Stuessy TF (1997) Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84, 1120-1136.

Categories