Paeonia suffruticosa

From ICG
Revision as of 13:29, 15 June 2017 by ICG Expert1 (talk | contribs) (Created page with "==Description== right|327px| * Tree peony (Paeonia suffruticosa) is a perennial plant indigenous to China known for its elegant and vibrantly co...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

REFqPCR2017007-1.jpg
  • Tree peony (Paeonia suffruticosa) is a perennial plant indigenous to China known for its elegant and vibrantly colorful flowers.
  • The peony is the peony family, the peony plant, is the perennial deciduous small shrub. The flowers are brightly colored, the jade smile is fragrant, the wind is handsome, the magnificence, has the reputation of "the king of flowers".
  • In the cultivated type, it is mainly based on the color of the flowers, which can be divided into hundreds of varieties. "Peony variety, colour and lustre are also more, with yellow, green, pinkish red, scarlet and vermillion after taste, yellow, green for you especially. Peony's big and sweet, so it is called" amusement ".
  • The papery flamboyant blooms and interesting foliage of tree peonies gives the impression that the plants are delicate. Thankfully, the complete opposite is true. Tree peonies are long-lived, hardy shrubs provided they are grown in a suitable spot. The common name is misleading as they are not trees but deciduous shrubs.[1] [2].

Flower Development & Different Cultivars

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • 'Feng Dan' & 'Xi Shi' cultivars
KU853028
  • F:CTGGAGTTTTCACCGACAAGG
  • R:CTGGAGTTTTCACCGACAAGG
186 60 SYBR
UBC[1] Ubiquitin conjugating enzyme
  • 'Feng Dan' &'Xi Shi' cultivars
KU853027
  • F:TACCCAAACAGCCCTCCAAC
  • R:TACCCAAACAGCCCTCCAAC
234 59 SYBR
EF-1α[1] Elongation factor 1 alpha
  • in 'Que Hao' cultivar
KU853032
  • F:TCCTGGGCATCGTGACTTTA
  • R:TCCTGGGCATCGTGACTTTA
232 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ji Yang
  • Email: jiyang@fudan.edu.cn
  • Institution: Ministry of Education Key Laboratory for Biodiversity Science and Ecological Engineering, Fudan University, Shanghai, China

References

  1. 1.0 1.1 1.2 1.3 Li J, Han J, Hu Y, Yang J (2016) Selection of Reference Genes for Quantitative Real-Time PCR during Flower Development in Tree Peony (Paeonia suffruticosa Andr.). Front Plant Sci 7, 516.
  2. Sang T, Crawford DJ, Stuessy TF (1997) Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84, 1120-1136.