Difference between revisions of "Panax ginseng"

Revision as of 01:36, 11 September 2017

Panax ginseng is a slow-growing perennial medicinal plant native to Asian. It is a member of the Araliaceae family and has served as one of the most well-known herbs worldwide for human health improvement. Triterpene saponins, named ginsenosides, are the main bioactive components in P. ginseng. It accounts for >4% of ginseng root dry weight. Ginseng growth has a strong correlation with the temperature. Cultivation of ginseng is difficult due to long growth period (4–6 years), diseases, and special growth condition requirements, which makes P. ginseng mainly distributed in the northeast region of China^[1]^[2].
Common Name: Ginseng
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
EF1-γ^[1]	Elongation factor 1-gamma	Leaves, stems, flowers, roots	KU215661	F: ATCGCATTAAAGAGAGCACTAGGA R: CATGGTCCAAAAATATCTCTCTACG	186	60.11	SYBR
IF3G1^[1]	Eukaryotic translation initiation factor 3G1	Leaves, stems, flowers, roots from 5-year-old ginseng plants and embryogenic calli Seedlings grown under heat stress	KU215663	F:GCGAACTAGAATATTTTCATCTCCA R:AGAAGAGAAGGGATAACAATTCCAT	208	59.9	SYBR
ACT11^[1]	Actin 11	Leaves, stems, flowers, roots from 5-year-old ginseng plants and embryogenic calli	KU215665	F:CCCGAGAGAAAGTATAGTGTATGGA R:TAGAGCTCTTCAACAACCACTTTTT	171	59.91	SYBR
EF1-β^[1]	elongation factor 1-beta	Leaves, stems, flowers, roots from 5-year-old ginseng plants and embryogenic calli	KU215660	F:AAGAAGAAAGAGAGTGGGAAATCAT R:TTTATCCCATAACCAACAGGAAGTA	158	60.02	SYBR
GAPDH^[1]	Glyceraldehyde 3-phosphate dehydrogenase	Seedlings grown under heat stress	AY345228	F:AAGGTTAAGGACAATAACACCCTTC R:AGGAGCTGAAATAACAACCTTCTTT	195	60.06	SYBR

Name: Shanfa Lu
Email: sflu@implad.ac.cn
Institution: Medicinal Plant Cultivation Research Center, Institute of Medicinal Plant Development, Beijing, China

Cited by 6 (Based on Google Scholar [2017-09-01]) 0

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 Wang M, Lu S (2015) Wang M, Lu S. Validation of Suitable Reference Genes for Quantitative Gene Expression Analysis in Panax ginseng. Front Plant Sci. 2016 Jan 12;6:1259. doi: 10.3389/fpls.2015.01259. eCollection 2015. PubMed PMID: 26793228; PubMed Central PMCID: PMC4709418.
↑ Yeo CR, Yong JJ, Popovich DG. Isolation and characterization of bioactive polyacetylenes Panax ginseng Meyer roots. J Pharm Biomed Anal. 2017 May 30;139:148-155. doi: 10.1016/j.jpba.2017.02.054. Epub 2017 Mar 1. PubMed PMID: 28282601.

@@ Line 107: / Line 107: @@
 </ref>
 <ref name="ref2">
-Yeo CR, Yong JJ, Popovich DG (2017) Isolation and characterization of bioactive polyacetylenes Panax ginseng Meyer roots. Journal of Pharmaceutical and Biomedical Analysis 139, 148-155.
+Yeo CR, Yong JJ, Popovich DG. Isolation and characterization of bioactive
+polyacetylenes Panax ginseng Meyer roots. J Pharm Biomed Anal. 2017 May
+;139:148-155. doi: 10.1016/j.jpba.2017.02.054. Epub 2017 Mar 1. PubMed PMID:
+28282601.
 </ref>
 </references>