Difference between revisions of "Panax ginseng"

From ICG
Jump to navigation Jump to search
Line 33: Line 33:
 
|align="center"| Eukaryotic translation initiation factor 3G1  
 
|align="center"| Eukaryotic translation initiation factor 3G1  
 
|
 
|
* Leaves, stems, flowers, roots from 5-year-old ginseng plants and embryogenic
+
* Leaves, stems, flowers, roots from 5-year-old ginseng plants and embryogenic calli
calli
 
 
* Seedlings grown under heat stress
 
* Seedlings grown under heat stress
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KU215663 '''KU215663''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KU215663 '''KU215663''']  
Line 47: Line 46:
 
|align="center"| Actin 11
 
|align="center"| Actin 11
 
|
 
|
* Leaves, stems, flowers, roots from 5-year-old ginseng plants and embryogenic
+
* Leaves, stems, flowers, roots from 5-year-old ginseng plants and embryogenic calli
calli
 
 
* Seedlings grown under heat stress
 
* Seedlings grown under heat stress
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KU215665 '''KU215665''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KU215665 '''KU215665''']  
Line 61: Line 59:
 
|align="center"| elongation factor 1-beta
 
|align="center"| elongation factor 1-beta
 
|
 
|
* Leaves, stems, flowers, roots from 5-year-old ginseng plants and embryogenic
+
* Leaves, stems, flowers, roots from 5-year-old ginseng plants and embryogenic calli
calli
 
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KU215660 '''KU215660 ''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KU215660 '''KU215660 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|

Revision as of 03:09, 18 August 2017

Description

Panax ginseng.png
  • Panax ginseng is a slow-growing perennial medicinal plant native to Asian. It is a member of the Araliaceae family and has served as one of the most well-known herbs worldwide for human health improvement. Triterpene saponins, named ginsenosides, are the main bioactive components in P. ginseng. It accounts for >4% of ginseng root dry weight. Ginseng growth has a strong correlation with the temperature. Cultivation of ginseng is difficult due to long growth period (4–6 years), diseases, and special growth condition requirements, which makes P. ginseng mainly distributed in the northeast region of China[1][2].
  • Common Name: Ginseng
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1-γ[1] Elongation factor 1-gamma
  • Leaves, stems, flowers, roots
KU215661
  • F: ATCGCATTAAAGAGAGCACTAGGA
  • R: CATGGTCCAAAAATATCTCTCTACG
186 60.11 SYBR
IF3G1[1] Eukaryotic translation initiation factor 3G1
  • Leaves, stems, flowers, roots from 5-year-old ginseng plants and embryogenic calli
  • Seedlings grown under heat stress
KU215663
  • F:GCGAACTAGAATATTTTCATCTCCA
  • R:AGAAGAGAAGGGATAACAATTCCAT
208 59.9 SYBR
ACT11[1] Actin 11
  • Leaves, stems, flowers, roots from 5-year-old ginseng plants and embryogenic calli
  • Seedlings grown under heat stress
KU215665
  • F:CCCGAGAGAAAGTATAGTGTATGGA
  • R:TAGAGCTCTTCAACAACCACTTTTT
171 59.91 SYBR
EF1-β[1] elongation factor 1-beta
  • Leaves, stems, flowers, roots from 5-year-old ginseng plants and embryogenic calli
KU215660
  • F:AAGAAGAAAGAGAGTGGGAAATCAT
  • R:TTTATCCCATAACCAACAGGAAGTA
158 60.02 SYBR
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Seedlings grown under heat stress
AY345228
  • F:AAGGTTAAGGACAATAACACCCTTC
  • R:AGGAGCTGAAATAACAACCTTCTTT
195 60.06 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Shanfa Lu
  • Email: sflu@implad.ac.cn
  • Institution: Medicinal Plant Cultivation Research Center, Institute of Medicinal Plant Development, Beijing, China

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-08-10])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Wang M, Lu S (2015) Validation of Suitable Reference Genes for Quantitative Gene Expression Analysis in Panax ginseng. Front Plant Sci 6, 1259.
  2. Yeo CR, Yong JJ, Popovich DG (2017) Isolation and characterization of bioactive polyacetylenes Panax ginseng Meyer roots. Journal of Pharmaceutical and Biomedical Analysis 139, 148-155.

Categories