Panax ginseng

From ICG
Revision as of 14:09, 15 June 2017 by ICG Expert1 (talk | contribs) (Created page with "==Description== right|327px| * Panax ginseng C.A. Meyer is a perennial medicinal plant native to Asian. It is a member of the Araliaceae family a...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

REFqPCR2015016-1.jpg
  • Panax ginseng C.A. Meyer is a perennial medicinal plant native to Asian. It is a member of the Araliaceae family and has been served as one of the most well-known herbs worldwide for human health improvement (Shibata, 2001). Triterpene saponins, named ginsenosides, are the main bioactive components in P. ginseng. It accounts for >4% of ginseng root dry weight.
  • Cultivation of ginseng is difficult due to long growth period (4–6 years), diseases, and special growth condition requirements, which makes P. ginseng mainly distributed in the northeast region of China. Large-scale cultivation of ginseng in Beijing is not successful yet. Ginseng growthhasastrongcorrelationwiththetemperature.The growth rate of ginseng reaches a peak at 18 ◦ C and then declines with the temperature increases.
  • Ginseng is a slow-growing perennial plant that belongs to the Araliaceae family and Panax genus. It is considered one of the most renowned herbs with more than 5500 years history of use in East Asia [1]. Two most popular ginseng species are the Asian ginseng (Panax ginseng Meyer) and American ginseng (Panax quinuquefolius L.). [1] [2].

Different Tissues & Stresses

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
EF1-γ[1] Elongation factor 1-gamma
  • Different tissues
  • Seedlings grown under heat stress
KU215661
  • F:ATCGCATTAAAGAGAGCACTAGGA
  • R:ATCGCATTAAAGAGAGCACTAGGA
186 60.11 SYBR
IF3G1[1] Eukaryotic translation initiation factor 3G1
  • Different tissues
  • Seedlings grown under heat stress
KU215663
  • F:GCGAACTAGAATATTTTCATCTCCA
  • R:GCGAACTAGAATATTTTCATCTCCA
208 59.9 SYBR
Actin 11[1] Elongation factor 1-gamma
  • Different tissues
  • Seedlings grown under heat stress
KU215665
  • F:CCCGAGAGAAAGTATAGTGTATGGA
  • R:CCCGAGAGAAAGTATAGTGTATGGA
171 59.91 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Shanfa Lu
  • Email: sflu@implad.ac.cn
  • Institution: Medicinal Plant Cultivation Research Center, Institute of Medicinal Plant Development, Beijing, China

References

  1. 1.0 1.1 1.2 1.3 Yeo CR, Yong JJ, Popovich DG (2017) Isolation and characterization of bioactive polyacetylenes Panax ginseng Meyer roots. Journal of Pharmaceutical and Biomedical Analysis 139, 148-155.
  2. Wang M, Lu S (2015) Validation of Suitable Reference Genes for Quantitative Gene Expression Analysis in Panax ginseng. Front Plant Sci 6, 1259.