Difference between revisions of "Panax notoginseng"

From ICG
Jump to navigation Jump to search
 
(2 intermediate revisions by 2 users not shown)
Line 47: Line 47:
 
|}
 
|}
  
===Moleculer types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 54: Line 55:
 
*'''Name''': Qiong Wu  
 
*'''Name''': Qiong Wu  
 
*'''Email''': qwu9516@gmail.com
 
*'''Email''': qwu9516@gmail.com
*'''Institute''': Guangdong Ecological Engineering Vocational College, Guangdong Forestry Vocational Technology School, Guangzhou 510520, China
+
*'''Institution''': Guangdong Ecological Engineering Vocational College, Guangdong Forestry Vocational Technology School, Guangzhou 510520, China
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''2''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=9090169209821726083&as_sdt=2005&sciodt=0,5&hl=en '''2'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==

Latest revision as of 05:20, 1 September 2017

Description

Panax notoginseng-1.jpg
  • Panax notoginseng (Burk.) F. H. Chen, a perennial medicinal herb, is endemic to southwest China, including Yunnan and Guangxi Provinces. It grows under forest shades on the slope of mountains at altitudes of 400–1,800 m above sea level and is used for pharmaceutical, health and cosmetic products. Various pharmaceutical drugs and compound preparations contain the roots of P. notoginseng as main materials [1][2].
  • Common Name: tienchi ginseng,san qi
  • NCBI Taxonomy

Different Tissue Types

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
26S-2[1] 26 S ribosomal RNA
  • Root, fibrous root, rhizome
  • Leaf, receptacle, pedicel
  • Fruit tissues
EC599969
  • F:CAGTATTTAGCCTTGGACGGAATT
  • R:CGGGTTGTTTGGGAATGC
60 60 SYBR
ACT-2[1] actin
  • Root, fibrous root, rhizome
  • Leaf, receptacle, pedicel
  • Fruit tissues
KF815706
  • F:GCCGATCTTTCCCTGTATGC
  • R:CATCACCAGAATCCAGCACAA
61 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Qiong Wu
  • Email: qwu9516@gmail.com
  • Institution: Guangdong Ecological Engineering Vocational College, Guangdong Forestry Vocational Technology School, Guangzhou 510520, China

Citation Statistics

Cited by 2 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Wu Q, Ma X, Zhang K, Feng X. Identification of reference genes for tissue-specific gene expression in Panax notoginseng using quantitative real-time PCR. Biotechnol Lett. 2015 Jan;37(1):197-204. doi: 10.1007/s10529-014-1643-x. Epub 2014 Sep 13. PubMed PMID: 25216645.
  2. Kundu A, Patel A, Pal A (2013) Defining reference genes for qPCR normalization to study biotic and abiotic stress responses in Vigna mungo. Plant Cell Rep 32:1647–1658

Categories