Difference between revisions of "Panax notoginseng"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
[[File:Panax notoginseng-1.jpg|right|200px|link=Panax notoginseng]]
 
[[File:Panax notoginseng-1.jpg|right|200px|link=Panax notoginseng]]
'''''Panax notoginseng''''' (Burk.) F. H. Chen, a perennial medicinal herb, is endemic to southwest China, including Yunnan and Guangxi Provinces. It grows under forest shades on the slope of mountains at altitudes of 400–1,800 m above sea level and is used for pharmaceutical, health and cosmetic products. Various pharmaceutical drugs and compound preparations contain the roots of P. notoginseng as main materials. P. notoginseng is recognized for its hemostatic, blood stasis-dissipating, discutient, and acesodyne effects. It is also used in the treatment of cardiovascular diseases, cerebrovascular diseases, diabetes, and obesity. <ref name="ref1"/><ref name="ref2"/>.
+
* '''''Panax notoginseng''''' (Burk.) F. H. Chen, a perennial medicinal herb, is endemic to southwest China, including Yunnan and Guangxi Provinces. It grows under forest shades on the slope of mountains at altitudes of 400–1,800 m above sea level and is used for pharmaceutical, health and cosmetic products. Various pharmaceutical drugs and compound preparations contain the roots of ''P. notoginseng'' as main materials. <ref name="ref1"/><ref name="ref2"/>.
 
* <font color=blue>'''Common Name:'''</font> ''' tienchi ginseng''','''san qi'''
 
* <font color=blue>'''Common Name:'''</font> ''' tienchi ginseng''','''san qi'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=44586 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=44586 <font color=blue>'''NCBI Taxonomy'''</font>]

Revision as of 06:30, 10 August 2017

Description

Panax notoginseng-1.jpg
  • Panax notoginseng (Burk.) F. H. Chen, a perennial medicinal herb, is endemic to southwest China, including Yunnan and Guangxi Provinces. It grows under forest shades on the slope of mountains at altitudes of 400–1,800 m above sea level and is used for pharmaceutical, health and cosmetic products. Various pharmaceutical drugs and compound preparations contain the roots of P. notoginseng as main materials. [1][2].
  • Common Name: tienchi ginseng,san qi
  • NCBI Taxonomy

Different Tissue Types

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
26S-2[1] 26 S ribosomal RNA
  • Root, fibrous root, rhizome
  • Leaf, receptacle, pedicel
  • Fruit tissues
EC599969
  • F:CAGTATTTAGCCTTGGACGGAATT
  • R:CGGGTTGTTTGGGAATGC
60 60 SYBR
ACT-2[1] actin
  • Root, fibrous root, rhizome
  • Leaf, receptacle, pedicel
  • Fruit tissues
KF815706
  • F:GCCGATCTTTCCCTGTATGC
  • R:CATCACCAGAATCCAGCACAA
61 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Qiong Wu
  • Email: qwu9516@gmail.com
  • Institute: Guangdong Ecological Engineering Vocational College, Guangdong Forestry Vocational Technology School, Guangzhou 510520, China

Citation Statistics

Cited by ?? (Based on Google Scholar [2017-08-01])

References

  1. 1.0 1.1 1.2 Wu Q, Ma X, Zhang K, Feng X. Identification of reference genes for tissue-specific gene expression in Panax notoginseng using quantitative real-time PCR. Biotechnol Lett. 2015 Jan;37(1):197-204. doi: 10.1007/s10529-014-1643-x. Epub 2014 Sep 13. PubMed PMID: 25216645.
  2. Kundu A, Patel A, Pal A (2013) Defining reference genes for qPCR normalization to study biotic and abiotic stress responses in Vigna mungo. Plant Cell Rep 32:1647–1658

Categories