Difference between revisions of "Panicum virgatum"

Revision as of 08:48, 11 August 2017

Panicum virgatum L. is a perennial warm-season grass native to North America and a productive C4 species. Used initially as a forage crop, switchgrass is currently being pursued as a dedicated cellulosic biofuel feedstock in the Midwestern and Southeastern United Sates^[1]^[2].
Common Name: Switchgrass
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
eEF-1a^[1]	Elongation factor 1a	Leaves, stems, rachis and roots Drought, salt stress treatment Cold and heat shock treatments, wounding stress	GR876801	F:CGGTTGGTCGTGTGGAGACT R:TGGTGCATCTCAACAGACTTCAC	100	60	SYBR
eIF-4a^[1]	Eukaryotic initiation factor 4a	Leaves, stems, rachis and roots Drought, salt stress treatment Cold and heat shock treatments, wounding stress	GR877213	F:TGATGTCATTCAGCAAGCACAA R:GGCATTCAACCAGGCCATAG	95	60	SYBR
CYP5^[1]	Cyclophilin 5	Leaves, stems, rachis and roots Drought, salt stress treatment Cold and heat shock treatments, wounding stress	FE633090	F:CACTACAAGGGAAGCACATTCCA R:TTCACCACCCCTTCCATCAC	95	60	SYBR
U2AF^[1]	Splicing factor U2af	Leaves, stems, rachis and roots Drought, salt stress treatment Cold and heat shock treatments, wounding stress	FL907910	F:GGGTCAACTGCCCTTTTTACTTC R:AGCACAAGAGTCGGCGATATG	100	60	SYBR

Name: Eduardo Blumwald
Email: eblumwald@ucdavis.edu
Institution: Department of Plant Pathology, University of California Davis, Davis, California, United States of America

Cited by 42 (Based on Google Scholar [2017-08-10])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 Gimeno J, Eattock N, Van Deynze A, et al. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum) using quantitative real-time RT-PCR[J]. PloS one, 2014, 9(3): e91474.
↑ Gimeno J, Eattock N, Van Deynze A, Blumwald E. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum) using quantitative real-time RT-PCR. PLoS One. 2014 Mar 12;9(3):e91474. doi: 10.1371/journal.pone.0091474. eCollection 2014. PubMed PMID: 24621568; PubMed Central PMCID: PMC3951385.

@@ Line 87: / Line 87: @@
 *'''Institution''': Department of Plant Pathology, University of California Davis, Davis, California, United States of America
 ===Citation Statistics===
-Cited by '''41''' (Based on Google Scholar [2017-06-16])
+Cited by '''42''' (Based on Google Scholar [2017-08-10])
 =='''References'''==