Panicum virgatum

From ICG
Jump to navigation Jump to search

Description

Panicum virgatum-1.jpg
  • Switchgrass (Panicum virgatum L.) is a perennial warm-season grass native to North America and a productive C4 species. Used initially as a forage crop, switchgrass is currently being pursued as a dedicated cellulosic biofuel feedstock in the Midwestern and Southeastern United Sates.
  • Switchgrass has been shown to produce 540% more renewable energy than energy consumed in its production and has significant environmental benefits related to soil conservation and low greenhouse gas emission. Its perennial nature allows efficient nutrient cycling to below ground organs for the subsequent seasons’ growth, a characteristic that allows substantial annual harvests with low nutrient and water requirements[1] [2].

Different Tissues & Atress Conditions

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
eEF-1a[1] elongation factor 1a
  • Universal reference gene
GR876801
  • F:CGGTTGGTCGTGTGGAGACT
  • R:TGGTGCATCTCAACAGACTTCAC
100 60 SYBR
eIF-4a[1] Eukaryotic initiation factor 4a
  • Universal reference gene
GR877213
  • F:TGATGTCATTCAGCAAGCACAA
  • R:GGCATTCAACCAGGCCATAG
95 60 SYBR
CYP5[1] Cyclophilin 5
  • Universal reference gene
FE633090
  • F:CACTACAAGGGAAGCACATTCCA
  • R:TTCACCACCCCTTCCATCAC
95 60 SYBR
U2AF[1] Splicing factor U2af
  • Universal reference gene
FL907910
  • F:GGGTCAACTGCCCTTTTTACTTC
  • R:AGCACAAGAGTCGGCGATATG
100 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Eduardo Blumwald
  • Email: eblumwald@ucdavis.edu
  • Institution: Department of Plant Pathology, University of California Davis, Davis, California, United States of America

Citation Statistics

Cited by 41 (Based on Google Scholar [2017-06-16])


References

  1. 1.0 1.1 1.2 1.3 1.4 Gimeno J, Eattock N, Van Deynze A, et al. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum) using quantitative real-time RT-PCR[J]. PloS one, 2014, 9(3): e91474.
  2. Gimeno J, Eattock N, Van Deynze A, Blumwald E. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum) using quantitative real-time RT-PCR. PLoS One. 2014 Mar 12;9(3):e91474. doi: 10.1371/journal.pone.0091474. eCollection 2014. PubMed PMID: 24621568; PubMed Central PMCID: PMC3951385.