Difference between revisions of "Panonychus citri"

From ICG
Jump to navigation Jump to search
 
(13 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
+
[[File:Panonychus citri.png|right|200px|link=Panonychus citri]]
[[File:Panonychus citri-1.jpg|right|327px|]]
+
* '''''Panonychus citri (McGregor)''''', is an economically important pest with a wide range of host plants and worldwide distribution. It is the most important allergen producing agent affecting citrus fruit farmers with asthma and rhinitis and a common sensitizing allergen in children living near citrus orchards. Although biological control of P. citri has proven successful in some horticulture crops, chemical acaricides have always played the central role in its control in fields. However, it can develop resistance to various acaricides rapidly due to their short life cycle, abundant progeny and arrhenotokous reproduction<ref name="ref1"/><ref name="ref2"/>.
* Panonychus citri (McGregor), is an economically important pest with a wide range of host plants (111 species recorded) and worldwide distribution. In addition, it is the most important allergen producing agent affecting citrus fruit farmers with asthma and rhinitis and a common sensitizing allergen in children living near citrus orchards. Although biological control of P. citri has proven successful in some horticulture crops, chemical acaricides have always played the central role in its control in fields.
+
* <font color=blue>'''Common Name:'''</font> ''' Citrus red spider mite'''
* The polyphagous species within the family Tetranychidae such as Tetranychus urticae, P. ulmi, and P. citri, are able to develop resistance to various acaricides rapidly due to their short life cycle, abundant progeny and arrhenotokous reproduction, and thus their control becomes exceedingly challenging<ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=50023 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Developmental Stages & Abiotic Stress'''''==
 
=='''''Different Developmental Stages & Abiotic Stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 21: Line 21:
 
|align="center"| Elongation factor-1 alpha  
 
|align="center"| Elongation factor-1 alpha  
 
|
 
|
* Various abiotic stresses
+
* Thermo stress, UV irradiation stress, acaricides stress
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/HM582444 '''HM582444''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/HM582444 '''HM582444''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 33: Line 33:
 
|align="center"| Glyceraldhyde-3-phosphate dehydrogenase
 
|align="center"| Glyceraldhyde-3-phosphate dehydrogenase
 
|
 
|
* Various abiotic stresses
+
* Thermo stress, UV irradiation stress, acaricides stress
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/308387507/ '''HM582445 ''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/308387507/ '''HM582445 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 43: Line 43:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 53: Line 53:
 
*'''Name''': Jin-Zhi Niu
 
*'''Name''': Jin-Zhi Niu
 
*'''Email''': jjwang7008@yahoo.com
 
*'''Email''': jjwang7008@yahoo.com
*'''Institute''': Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 400716, People’s Republic of China
+
*'''Institution''': Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 400716, People’s Republic of China
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''39''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=14935951330608195010&as_sdt=2005&sciodt=0,5&hl=en '''40'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 66: Line 67:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
  
 
[[Category:SYBR]]
 
[[Category:SYBR]]
[[Category:eIF]] [[Category:GAPDH]]
+
[[Category:EF1α]] [[Category:GAPDH]]
 +
[[Category:Abiotic Stress]]  [[Category:Different Developmental Stages]]
 +
 
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 04:32, 1 September 2017

Description

Panonychus citri.png
  • Panonychus citri (McGregor), is an economically important pest with a wide range of host plants and worldwide distribution. It is the most important allergen producing agent affecting citrus fruit farmers with asthma and rhinitis and a common sensitizing allergen in children living near citrus orchards. Although biological control of P. citri has proven successful in some horticulture crops, chemical acaricides have always played the central role in its control in fields. However, it can develop resistance to various acaricides rapidly due to their short life cycle, abundant progeny and arrhenotokous reproduction[1][2].
  • Common Name: Citrus red spider mite
  • NCBI Taxonomy

Different Developmental Stages & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ELF1A[1] Elongation factor-1 alpha
  • Thermo stress, UV irradiation stress, acaricides stress
HM582444
  • F:GGCACTTCGTCTTCCACTTC
  • R:ATGATTCGTGGTGCATCTCA
164 60 SYBR
GAPDH[1] Glyceraldhyde-3-phosphate dehydrogenase
  • Thermo stress, UV irradiation stress, acaricides stress
HM582445
  • F:CTTTGGCCAAGGTCATCAAT
  • R:CGGTAGCGGCAGGTATAATG
159 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jin-Zhi Niu
  • Email: jjwang7008@yahoo.com
  • Institution: Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 400716, People’s Republic of China

Citation Statistics

Cited by 40 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Niu J Z, Dou W, Ding T B, et al. Evaluation of suitable reference genes for quantitative RT-PCR during development and abiotic stress in Panonychus citri (McGregor)(Acari: Tetranychidae)[J]. Molecular biology reports, 2012, 39(5): 5841-5849.
  2. Hendriks-Balk M, Michel M, Alewijnse A (2007) Pitfalls in the normalization of real-time polymerase chain reaction data. Basic Res Cardiol 102(3):195–197. doi:10.1007/s00395-007-0649-0.

Categories