Difference between revisions of "Panonychus citri"

From ICG
Jump to navigation Jump to search
Line 71: Line 71:
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 
[[Category:eIF]] [[Category:GAPDH]]
 
[[Category:eIF]] [[Category:GAPDH]]
 +
[[Category:Abiotic Stress]]  [[Category:Different Developmental Stages]]

Revision as of 15:03, 21 June 2017

Description

Panonychus citri-1.jpg
  • Panonychus citri (McGregor), is an economically important pest with a wide range of host plants (111 species recorded) and worldwide distribution. In addition, it is the most important allergen producing agent affecting citrus fruit farmers with asthma and rhinitis and a common sensitizing allergen in children living near citrus orchards. Although biological control of P. citri has proven successful in some horticulture crops, chemical acaricides have always played the central role in its control in fields.
  • The polyphagous species within the family Tetranychidae such as Tetranychus urticae, P. ulmi, and P. citri, are able to develop resistance to various acaricides rapidly due to their short life cycle, abundant progeny and arrhenotokous reproduction, and thus their control becomes exceedingly challenging[1] [2].

Different Developmental Stages & Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ELF1A[1] Elongation factor-1 alpha
  • Various abiotic stresses
HM582444
  • F:GGCACTTCGTCTTCCACTTC
  • R:ATGATTCGTGGTGCATCTCA
164 60 SYBR
GAPDH[1] Glyceraldhyde-3-phosphate dehydrogenase
  • Various abiotic stresses
HM582445
  • F:CTTTGGCCAAGGTCATCAAT
  • R:CGGTAGCGGCAGGTATAATG
159 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jin-Zhi Niu
  • Email: jjwang7008@yahoo.com
  • Institute: Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 400716, People’s Republic of China

Citation Statistics

Cited by 39 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Niu J Z, Dou W, Ding T B, et al. Evaluation of suitable reference genes for quantitative RT-PCR during development and abiotic stress in Panonychus citri (McGregor)(Acari: Tetranychidae)[J]. Molecular biology reports, 2012, 39(5): 5841-5849.
  2. Hendriks-Balk M, Michel M, Alewijnse A (2007) Pitfalls in the normalization of real-time polymerase chain reaction data. Basic Res Cardiol 102(3):195–197. doi:10.1007/s00395-007-0649-0.