Difference between revisions of "Paralichthys olivaceus"

From ICG
Jump to navigation Jump to search
Line 162: Line 162:
  
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 +
[[Category:Tubulin]]

Revision as of 09:00, 19 June 2017

Description

Paralichthys olivaceus-1.jpg
  • Japanese flounder (Paralichthys olivaceus) is an important economic fish species cultured worldwide.Japanese flounder (Paralichthys olivaceus), a species of flatfish, is one of the most important fish species cultured in Asian countries including Japan, Korea, and China.
  • Japanese flounder (Paralichthys olivaceus) is an economically important marine fish in Japan, China and Korea. [1] [2]

Before & After Bacterial Infection

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
TUBA [1] a -tubulin
  • Spleen
  • Heart
  • Muscle
  • Gill
AU050297
  • F:TGACATCACAAACGCCTGCTTC
  • R:GCACCACATCTCCACGGTACAG
107 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Li Sun
  • Email: lsun@qdio.ac.cn
  • Institute: Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, PR China

Viral Infection

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTB[2] β-actin
  • 24h post-viral infection in brain, gill, live, Heart
  • 72h post-viral infection in brain, gill, liver, Heart
EU090804
  • F:CGCTGCCTCCTCCTCATC
  • R:ATACCACAAGACTCCATTCCAAG
135 59 SYBR
eIF5A[2] β-actin
  • 24h post-viral infection in brain, liver
  • 72h post-viral infection in brain, Spleen
FJ390056
  • F:GAACGAAGAAGCCGCCATC
  • R:GTAGGAAGGTTGGAGAACAGAG
193 59 SYBR
GAPDH[2] Glyceraldehyde-3-phosphate dehydrogenase
  • 24h post-viral infection in Gill, Muscle
  • 72h post-viral infection in Gill, Muscle
AB029337
  • F:CGGCGACACTCACTCCTC
  • R:TCTGATTGGTTGGTTGGTTGG
170 59 SYBR
UBCE[2] Ubiquitin-conjugating enzyme
  • 24h post-viral infection in Heart, Muscle, Intestine, Kidney
  • 72h post-viral infection in in Heart, Intestine, Kidney
AJ298327
  • F:CACCATCACAGGACCGAATG
  • R:GATGTCAAGGCAGATGCTACC
170 59 SYBR
TUBA[2] α-Tubulin
  • 24h post-viral infection in Heart, Muscle, Intestine, Kidney
  • 72h post-viral infection in Heart, Intestine, Kidney
JN635277
  • F:TGACATCACAAACGCCTGCTTC
  • R:GCACCACATCTCCACGGTACAG
107 59 SYBR
EF1A[2] Elongation factor-1-α
  • 24h post-viral infection in Kidney, Spleen
  • 72h post-viral infection in Intestine, Spleen, Kidney
AB240552
  • F:CTACAAGTGCGGAGGAATCG
  • R:GTCCAGGAGCGTCAATGATG
200 59 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Li Sun
  • Email: lsun@qdio.ac.cn
  • Institution: Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 Zheng W, Sun L. Evaluation of housekeeping genes as references for quantitative real time RT-PCR analysis of gene expression in Japanese flounder (Paralichthys olivaceus)[J]. Fish & shellfish immunology, 2011, 30(2): 638-645.
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 Zhang J, Hu Y, Sun B, et al. Selection of normalization factors for quantitative real time RT-PCR studies in Japanese flounder (Paralichthys olivaceus) and turbot (Scophthalmus maximus) under conditions of viral infection[J]. Veterinary immunology and immunopathology, 2013, 152(3): 303-316.