Difference between revisions of "Paralichthys olivaceus"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== =='''''Before & After Bacterial Infection'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol...")
 
Line 17: Line 17:
 
|align="center"| a -tubulin
 
|align="center"| a -tubulin
 
|
 
|
*spleen;* heart;* muscle;*gill
+
*spleen;
 +
* heart;
 +
* muscle;
 +
*gill
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/AU050297 '''AU050297''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/AU050297 '''AU050297''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 26: Line 29:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
 +
 
===Moleculer types===
 
===Moleculer types===
 
* mRNA
 
* mRNA

Revision as of 14:13, 16 June 2017

Description

Before & After Bacterial Infection

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
TUBA [1] a -tubulin
  • spleen;
  • heart;
  • muscle;
  • gill
AU050297
  • F:TGACATCACAAACGCCTGCTTC
  • R:GCACCACATCTCCACGGTACAG
107 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Li Sun
  • Email: lsun@qdio.ac.cn
  • Institute: Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, PR China

References

  1. Zheng W, Sun L. Evaluation of housekeeping genes as references for quantitative real time RT-PCR analysis of gene expression in Japanese flounder (Paralichthys olivaceus)[J]. Fish & shellfish immunology, 2011, 30(2): 638-645.