Difference between revisions of "Paralichthys olivaceus"

From ICG
Jump to navigation Jump to search
 
(19 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 +
[[File:Paralichthys olivaceus.png|right|200px|link=Paralichthys olivaceus]]
 +
* '''''Paralichthys olivaceus''''', a species of flatfish, is one of the most economic important fish species cultured in Asian countries including Japan, Korea, and China. It is a temperate marine species and grows fastest at 15 to 25°C. It is proved to be a species with unstable sex-differentiation that is influenced by environmental factors<ref name="ref1"/><ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Olive flounder''','''Japanese flounder'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=8255 <font color=blue>'''NCBI Taxonomy'''</font>]
  
−
[[File:Paralichthys olivaceus-1.jpg|right|327px|]]
 
−
* Japanese flounder (Paralichthys olivaceus) is an important economic fish species cultured worldwide.Japanese flounder (Paralichthys olivaceus), a species of flatfish, is one of the most important fish species cultured in Asian countries including Japan, Korea, and China.
 
−
* Japanese flounder (Paralichthys olivaceus) is an economically important marine fish in Japan, China and Korea. <ref name="ref1"/> <ref name="ref2"/>
 
 
=='''''Before & After Bacterial Infection'''''==
 
=='''''Before & After Bacterial Infection'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 18: Line 19:
 
|-
 
|-
 
|align="center"| TUBA <ref name="ref1"/>
 
|align="center"| TUBA <ref name="ref1"/>
−
|align="center"| a -tubulin
+
|align="center"| α -tubulin
 
|
 
|
 
*Spleen
 
*Spleen
Line 33: Line 34:
 
|}
 
|}
  
−
===Moleculer types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 41: Line 43:
 
*'''Name''':  Li Sun
 
*'''Name''':  Li Sun
 
*'''Email''': lsun@qdio.ac.cn
 
*'''Email''': lsun@qdio.ac.cn
−
*'''Institute''':  Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, PR China
+
*'''Institution''':  Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, PR China
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''105''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=16240780444190981113&as_sdt=2005&sciodt=0,5&hl=en '''106'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Viral Infection'''''==
 
=='''''Viral Infection'''''==
  
  
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 113: Line 116:
 
|-
 
|-
 
|align="center"| TUBA<ref name="ref2"/>
 
|align="center"| TUBA<ref name="ref2"/>
−
|align="center"| α-Tubulin
+
|align="center"| α-tubulin
 
|
 
|
 
* 24h post-viral infection in heart, muscle, intestine, kidney
 
* 24h post-viral infection in heart, muscle, intestine, kidney
Line 138: Line 141:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
−
===Moleculer Types===
+
 
 +
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 149: Line 154:
 
*'''Institution''': Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China
 
*'''Institution''': Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''15''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=487178205599622280&as_sdt=2005&sciodt=0,5&hl=en '''17'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 160: Line 165:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
Line 166: Line 172:
 
[[Category:Tubulin]]
 
[[Category:Tubulin]]
 
[[Category:Biotic Stress]]  [[Category:Pathological conditions]]  [[Category:Bacterial Infection]]
 
[[Category:Biotic Stress]]  [[Category:Pathological conditions]]  [[Category:Bacterial Infection]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 04:34, 1 September 2017

Description

Paralichthys olivaceus.png
  • Paralichthys olivaceus, a species of flatfish, is one of the most economic important fish species cultured in Asian countries including Japan, Korea, and China. It is a temperate marine species and grows fastest at 15 to 25°C. It is proved to be a species with unstable sex-differentiation that is influenced by environmental factors[1][2].
  • Common Name: Olive flounder,Japanese flounder
  • NCBI Taxonomy

Before & After Bacterial Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
TUBA [1] α -tubulin
  • Spleen
  • Heart
  • Muscle
  • Gill
 AU050297
  • F:TGACATCACAAACGCCTGCTTC
  • R:GCACCACATCTCCACGGTACAG
 107 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Li Sun
  • Email: lsun@qdio.ac.cn
  • Institution: Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, PR China

Citation Statistics

Cited by 106 (Based on Google Scholar [2017-09-01])

Viral Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
ACTB[2] β-actin
  • 24h post-viral infection in brain, gill, live, Heart
  • 72h post-viral infection in brain, gill, liver, Heart
 EU090804
  • F:CGCTGCCTCCTCCTCATC
  • R:ATACCACAAGACTCCATTCCAAG
 135 59 SYBR
eIF5A[2] β-actin
  • 24h post-viral infection in brain, liver
  • 72h post-viral infection in brain, spleen
 FJ390056
  • F:GAACGAAGAAGCCGCCATC
  • R:GTAGGAAGGTTGGAGAACAGAG
 193 59 SYBR
GAPDH[2] Glyceraldehyde-3-phosphate dehydrogenase
  • 24h post-viral infection in gill, muscle
  • 72h post-viral infection in gill, muscle
 AB029337
  • F:CGGCGACACTCACTCCTC
  • R:TCTGATTGGTTGGTTGGTTGG
 170 59 SYBR
UBCE[2] Ubiquitin-conjugating enzyme
  • 24h post-viral infection in heart, muscle, intestine, kidney
  • 72h post-viral infection in in heart, intestine,kidney
 AJ298327
  • F:CACCATCACAGGACCGAATG
  • R:GATGTCAAGGCAGATGCTACC
 170 59 SYBR
TUBA[2] α-tubulin
  • 24h post-viral infection in heart, muscle, intestine, kidney
  • 72h post-viral infection in heart, intestine, kidney
 JN635277
  • F:TGACATCACAAACGCCTGCTTC
  • R:GCACCACATCTCCACGGTACAG
 107 59 SYBR
EF1A[2] Elongation factor-1-α
  • 24h post-viral infection in kidney, spleen
  • 72h post-viral infection in intestine, spleen, kidney
 AB240552
  • F:CTACAAGTGCGGAGGAATCG
  • R:GTCCAGGAGCGTCAATGATG
 200 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Li Sun
  • Email: lsun@qdio.ac.cn
  • Institution: Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China

Citation Statistics

Cited by 17 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 Zheng W, Sun L. Evaluation of housekeeping genes as references for quantitative real time RT-PCR analysis of gene expression in Japanese flounder (Paralichthys olivaceus)[J]. Fish & shellfish immunology, 2011, 30(2): 638-645.
  2. ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 Zhang J, Hu Y, Sun B, et al. Selection of normalization factors for quantitative real time RT-PCR studies in Japanese flounder (Paralichthys olivaceus) and turbot (Scophthalmus maximus) under conditions of viral infection[J]. Veterinary immunology and immunopathology, 2013, 152(3): 303-316.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Paralichthys_olivaceus&oldid=8558"