Difference between revisions of "Paralichthys olivaceus"
Jump to navigation
Jump to search
Cao Jiabao (talk | contribs) |
|||
(36 intermediate revisions by 7 users not shown) | |||
Line 1: | Line 1: | ||
=='''Description'''== | =='''Description'''== | ||
+ | [[File:Paralichthys olivaceus.png|right|200px|link=Paralichthys olivaceus]] | ||
+ | * '''''Paralichthys olivaceus''''', a species of flatfish, is one of the most economic important fish species cultured in Asian countries including Japan, Korea, and China. It is a temperate marine species and grows fastest at 15 to 25°C. It is proved to be a species with unstable sex-differentiation that is influenced by environmental factors<ref name="ref1"/><ref name="ref2"/>. | ||
+ | * <font color=blue>'''Common Name:'''</font> '''Olive flounder''','''Japanese flounder''' | ||
+ | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=8255 <font color=blue>'''NCBI Taxonomy'''</font>] | ||
=='''''Before & After Bacterial Infection'''''== | =='''''Before & After Bacterial Infection'''''== | ||
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 9: | Line 13: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 15: | Line 19: | ||
|- | |- | ||
|align="center"| TUBA <ref name="ref1"/> | |align="center"| TUBA <ref name="ref1"/> | ||
− | |align="center"| | + | |align="center"| α -tubulin |
| | | | ||
− | * | + | *Spleen |
− | * | + | *Heart |
− | * | + | *Muscle |
− | * | + | *Gill |
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/AU050297 '''AU050297'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/AU050297 '''AU050297'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 30: | Line 34: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
* mRNA | * mRNA | ||
+ | |||
===Evaluation Methods=== | ===Evaluation Methods=== | ||
* [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
Line 38: | Line 43: | ||
*'''Name''': Li Sun | *'''Name''': Li Sun | ||
*'''Email''': lsun@qdio.ac.cn | *'''Email''': lsun@qdio.ac.cn | ||
− | *''' | + | *'''Institution''': Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, PR China |
+ | |||
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=16240780444190981113&as_sdt=2005&sciodt=0,5&hl=en '''106'''] (Based on Google Scholar [2017-09-01]) | ||
+ | |||
+ | =='''''Viral Infection'''''== | ||
+ | |||
+ | |||
+ | ===Internal Control Genes=== | ||
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primers (5'-3')<br>[Forward/Reverse] | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| ACTB<ref name="ref2"/> | ||
+ | |align="center"| β-actin | ||
+ | | | ||
+ | * 24h post-viral infection in brain, gill, live, Heart | ||
+ | * 72h post-viral infection in brain, gill, liver, Heart | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EU090804 '''EU090804'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CGCTGCCTCCTCCTCATC | ||
+ | * R:ATACCACAAGACTCCATTCCAAG | ||
+ | |align="center"| 135 | ||
+ | |align="center"| 59 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| eIF5A<ref name="ref2"/> | ||
+ | |align="center"| β-actin | ||
+ | | | ||
+ | * 24h post-viral infection in brain, liver | ||
+ | * 72h post-viral infection in brain, spleen | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/FJ390056 '''FJ390056'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GAACGAAGAAGCCGCCATC | ||
+ | * R:GTAGGAAGGTTGGAGAACAGAG | ||
+ | |align="center"| 193 | ||
+ | |align="center"| 59 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| GAPDH<ref name="ref2"/> | ||
+ | |align="center"| Glyceraldehyde-3-phosphate dehydrogenase | ||
+ | | | ||
+ | * 24h post-viral infection in gill, muscle | ||
+ | * 72h post-viral infection in gill, muscle | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB029337 '''AB029337'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CGGCGACACTCACTCCTC | ||
+ | * R:TCTGATTGGTTGGTTGGTTGG | ||
+ | |align="center"| 170 | ||
+ | |align="center"| 59 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| UBCE<ref name="ref2"/> | ||
+ | |align="center"| Ubiquitin-conjugating enzyme | ||
+ | | | ||
+ | * 24h post-viral infection in heart, muscle, intestine, kidney | ||
+ | * 72h post-viral infection in in heart, intestine,kidney | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AJ298327 '''AJ298327'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CACCATCACAGGACCGAATG | ||
+ | * R:GATGTCAAGGCAGATGCTACC | ||
+ | |align="center"| 170 | ||
+ | |align="center"| 59 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| TUBA<ref name="ref2"/> | ||
+ | |align="center"| α-tubulin | ||
+ | | | ||
+ | * 24h post-viral infection in heart, muscle, intestine, kidney | ||
+ | * 72h post-viral infection in heart, intestine, kidney | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/JN635277 '''JN635277'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:TGACATCACAAACGCCTGCTTC | ||
+ | * R:GCACCACATCTCCACGGTACAG | ||
+ | |align="center"| 107 | ||
+ | |align="center"| 59 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| EF1A<ref name="ref2"/> | ||
+ | |align="center"| Elongation factor-1-α | ||
+ | | | ||
+ | * 24h post-viral infection in kidney, spleen | ||
+ | * 72h post-viral infection in intestine, spleen, kidney | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB240552 '''AB240552'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CTACAAGTGCGGAGGAATCG | ||
+ | * R:GTCCAGGAGCGTCAATGATG | ||
+ | |align="center"| 200 | ||
+ | |align="center"| 59 | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | |||
+ | ===Molecular Types=== | ||
+ | *mRNA | ||
+ | |||
+ | ===Evaluation Methods=== | ||
+ | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
+ | * [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference'''] | ||
+ | |||
+ | ===Contact=== | ||
+ | *'''Name''': Li Sun | ||
+ | *'''Email''': lsun@qdio.ac.cn | ||
+ | *'''Institution''': Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China | ||
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=487178205599622280&as_sdt=2005&sciodt=0,5&hl=en '''17'''] (Based on Google Scholar [2017-09-01]) | ||
+ | |||
=='''References'''== | =='''References'''== | ||
<references> | <references> | ||
<ref name="ref1"> | <ref name="ref1"> | ||
Zheng W, Sun L. Evaluation of housekeeping genes as references for quantitative real time RT-PCR analysis of gene expression in Japanese flounder (Paralichthys olivaceus)[J]. Fish & shellfish immunology, 2011, 30(2): 638-645. | Zheng W, Sun L. Evaluation of housekeeping genes as references for quantitative real time RT-PCR analysis of gene expression in Japanese flounder (Paralichthys olivaceus)[J]. Fish & shellfish immunology, 2011, 30(2): 638-645. | ||
+ | </ref> | ||
+ | <ref name="ref2"> | ||
+ | Zhang J, Hu Y, Sun B, et al. Selection of normalization factors for quantitative real time RT-PCR studies in Japanese flounder (Paralichthys olivaceus) and turbot (Scophthalmus maximus) under conditions of viral infection[J]. Veterinary immunology and immunopathology, 2013, 152(3): 303-316. | ||
</ref> | </ref> | ||
</references> | </references> | ||
+ | =='''Categories'''== | ||
+ | [[Category:Animals]] | ||
+ | [[Category:mRNA]] | ||
+ | |||
+ | [[Category:SYBR]] | ||
+ | [[Category:Tubulin]] | ||
+ | [[Category:Biotic Stress]] [[Category:Pathological conditions]] [[Category:Bacterial Infection]] | ||
+ | |||
+ | [[Category:geNorm]] | ||
+ | [[Category:NormFinder]] |
Latest revision as of 04:34, 1 September 2017
Contents
Description
- Paralichthys olivaceus, a species of flatfish, is one of the most economic important fish species cultured in Asian countries including Japan, Korea, and China. It is a temperate marine species and grows fastest at 15 to 25°C. It is proved to be a species with unstable sex-differentiation that is influenced by environmental factors[1][2].
- Common Name: Olive flounder,Japanese flounder
- NCBI Taxonomy
Before & After Bacterial Infection
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
TUBA [1] | α -tubulin |
|
AU050297 |
|
107 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
Contact
- Name: Li Sun
- Email: lsun@qdio.ac.cn
- Institution: Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, PR China
Citation Statistics
Cited by 106 (Based on Google Scholar [2017-09-01])
Viral Infection
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
ACTB[2] | β-actin |
|
EU090804 |
|
135 | 59 | SYBR |
eIF5A[2] | β-actin |
|
FJ390056 |
|
193 | 59 | SYBR |
GAPDH[2] | Glyceraldehyde-3-phosphate dehydrogenase |
|
AB029337 |
|
170 | 59 | SYBR |
UBCE[2] | Ubiquitin-conjugating enzyme |
|
AJ298327 |
|
170 | 59 | SYBR |
TUBA[2] | α-tubulin |
|
JN635277 |
|
107 | 59 | SYBR |
EF1A[2] | Elongation factor-1-α |
|
AB240552 |
|
200 | 59 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
Contact
- Name: Li Sun
- Email: lsun@qdio.ac.cn
- Institution: Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China
Citation Statistics
Cited by 17 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 Zheng W, Sun L. Evaluation of housekeeping genes as references for quantitative real time RT-PCR analysis of gene expression in Japanese flounder (Paralichthys olivaceus)[J]. Fish & shellfish immunology, 2011, 30(2): 638-645.
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 Zhang J, Hu Y, Sun B, et al. Selection of normalization factors for quantitative real time RT-PCR studies in Japanese flounder (Paralichthys olivaceus) and turbot (Scophthalmus maximus) under conditions of viral infection[J]. Veterinary immunology and immunopathology, 2013, 152(3): 303-316.