Difference between revisions of "Paralichthys olivaceus"
Jump to navigation
Jump to search
ICG Expert4 (talk | contribs) |
|||
Line 42: | Line 42: | ||
*'''Email''': lsun@qdio.ac.cn | *'''Email''': lsun@qdio.ac.cn | ||
*'''Institute''': Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, PR China | *'''Institute''': Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, PR China | ||
+ | |||
+ | =='''''Viral Infection'''''== | ||
+ | |||
+ | |||
+ | ===Reference Genes=== | ||
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primer | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| ACTB<ref name="ref1"/> | ||
+ | |align="center"| β-actin | ||
+ | | | ||
+ | * 24h post-viral infection in brain, gill, live, Heart | ||
+ | * 72h post-viral infection in brain, gill, liver, Heart | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EU090804 '''EU090804'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CGCTGCCTCCTCCTCATC | ||
+ | * R:ATACCACAAGACTCCATTCCAAG | ||
+ | |align="center"| 135 | ||
+ | |align="center"| 59 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| eIF5A<ref name="ref1"/> | ||
+ | |align="center"| β-actin | ||
+ | | | ||
+ | * 24h post-viral infection in brain, liver | ||
+ | * 72h post-viral infection in brain, Spleen | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/FJ390056 '''FJ390056'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GAACGAAGAAGCCGCCATC | ||
+ | * R:GTAGGAAGGTTGGAGAACAGAG | ||
+ | |align="center"| 193 | ||
+ | |align="center"| 59 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| GAPDH<ref name="ref1"/> | ||
+ | |align="center"| Glyceraldehyde-3-phosphate dehydrogenase | ||
+ | | | ||
+ | * 24h post-viral infection in Gill, Muscle | ||
+ | * 72h post-viral infection in Gill, Muscle | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB029337 '''AB029337'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CGGCGACACTCACTCCTC | ||
+ | * R:TCTGATTGGTTGGTTGGTTGG | ||
+ | |align="center"| 170 | ||
+ | |align="center"| 59 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| UBCE<ref name="ref1"/> | ||
+ | |align="center"| Ubiquitin-conjugating enzyme | ||
+ | | | ||
+ | * 24h post-viral infection in Heart, Muscle, Intestine, Kidney | ||
+ | * 72h post-viral infection in in Heart, Intestine, Kidney | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AJ298327 '''AJ298327'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CACCATCACAGGACCGAATG | ||
+ | * R:GATGTCAAGGCAGATGCTACC | ||
+ | |align="center"| 170 | ||
+ | |align="center"| 59 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| TUBA<ref name="ref1"/> | ||
+ | |align="center"| α-Tubulin | ||
+ | | | ||
+ | * 24h post-viral infection in Heart, Muscle, Intestine, Kidney | ||
+ | * 72h post-viral infection in Heart, Intestine, Kidney | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/JN635277 '''JN635277'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:TGACATCACAAACGCCTGCTTC | ||
+ | * R:GCACCACATCTCCACGGTACAG | ||
+ | |align="center"| 107 | ||
+ | |align="center"| 59 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| EF1A<ref name="ref1"/> | ||
+ | |align="center"| Elongation factor-1-α | ||
+ | | | ||
+ | * 24h post-viral infection in Kidney, Spleen | ||
+ | * 72h post-viral infection in Intestine, Spleen, Kidney | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB240552 '''AB240552'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CTACAAGTGCGGAGGAATCG | ||
+ | * R:GTCCAGGAGCGTCAATGATG | ||
+ | |align="center"| 200 | ||
+ | |align="center"| 59 | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | |||
=='''References'''== | =='''References'''== | ||
<references> | <references> |
Revision as of 04:49, 17 June 2017
Contents
Description
- Japanese flounder (Paralichthys olivaceus) is an important economic fish species cultured worldwide.Japanese flounder (Paralichthys olivaceus), a species of flatfish, is one of the most important fish species cultured in Asian countries including Japan, Korea, and China.
- Japanese flounder (Paralichthys olivaceus) is an economically important marine fish in Japan, China and Korea.
Before & After Bacterial Infection
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
TUBA [1] | a -tubulin |
|
AU050297 |
|
107 | 60 | SYBR |
Moleculer types
- mRNA
Evaluation Methods
Contact
- Name: Li Sun
- Email: lsun@qdio.ac.cn
- Institute: Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, PR China
Viral Infection
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
ACTB[1] | β-actin |
|
EU090804 |
|
135 | 59 | SYBR |
eIF5A[1] | β-actin |
|
FJ390056 |
|
193 | 59 | SYBR |
GAPDH[1] | Glyceraldehyde-3-phosphate dehydrogenase |
|
AB029337 |
|
170 | 59 | SYBR |
UBCE[1] | Ubiquitin-conjugating enzyme |
|
AJ298327 |
|
170 | 59 | SYBR |
TUBA[1] | α-Tubulin |
|
JN635277 |
|
107 | 59 | SYBR |
EF1A[1] | Elongation factor-1-α |
|
AB240552 |
|
200 | 59 | SYBR |
References
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Zheng W, Sun L. Evaluation of housekeeping genes as references for quantitative real time RT-PCR analysis of gene expression in Japanese flounder (Paralichthys olivaceus)[J]. Fish & shellfish immunology, 2011, 30(2): 638-645.
Cite error: <ref>
tag with name "ref2" defined in <references>
is not used in prior text.