Difference between revisions of "Paralichthys olivaceus"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:Paralichthys olivaceus.png|right|200px|]]
+
[[File:Paralichthys olivaceus.png|right|200px|link=Paralichthys olivaceus]]
 
* '''''Paralichthys olivaceus''''', a species of flatfish, is one of the most economic important fish species cultured in Asian countries including Japan, Korea, and China. It is a temperate marine species and grows fastest at 15 to 25°C. It is proved to be a species with unstable sex-differentiation that is influenced by environmental factors<ref name=""ref1""/><ref name=""ref2""/>.
 
* '''''Paralichthys olivaceus''''', a species of flatfish, is one of the most economic important fish species cultured in Asian countries including Japan, Korea, and China. It is a temperate marine species and grows fastest at 15 to 25°C. It is proved to be a species with unstable sex-differentiation that is influenced by environmental factors<ref name=""ref1""/><ref name=""ref2""/>.
 
* <font color=blue>'''Common Name:'''</font> '''Olive flounder''','''Japanese flounder'''
 
* <font color=blue>'''Common Name:'''</font> '''Olive flounder''','''Japanese flounder'''

Revision as of 07:45, 29 June 2017

Description

Paralichthys olivaceus.png
  • Paralichthys olivaceus, a species of flatfish, is one of the most economic important fish species cultured in Asian countries including Japan, Korea, and China. It is a temperate marine species and grows fastest at 15 to 25°C. It is proved to be a species with unstable sex-differentiation that is influenced by environmental factors[1][1].
  • Common Name: Olive flounder,Japanese flounder
  • NCBI Taxonomy

Before & After Bacterial Infection

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
TUBA [2] α -tubulin
  • Spleen
  • Heart
  • Muscle
  • Gill
AU050297
  • F:TGACATCACAAACGCCTGCTTC
  • R:GCACCACATCTCCACGGTACAG
107 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Li Sun
  • Email: lsun@qdio.ac.cn
  • Institution: Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, PR China

Citation Statistics

Cited by 105 (Based on Google Scholar [2017-06-16])

Viral Infection

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACTB[3] β-actin
  • 24h post-viral infection in brain, gill, live, Heart
  • 72h post-viral infection in brain, gill, liver, Heart
EU090804
  • F:CGCTGCCTCCTCCTCATC
  • R:ATACCACAAGACTCCATTCCAAG
135 59 SYBR
eIF5A[3] β-actin
  • 24h post-viral infection in brain, liver
  • 72h post-viral infection in brain, spleen
FJ390056
  • F:GAACGAAGAAGCCGCCATC
  • R:GTAGGAAGGTTGGAGAACAGAG
193 59 SYBR
GAPDH[3] Glyceraldehyde-3-phosphate dehydrogenase
  • 24h post-viral infection in gill, muscle
  • 72h post-viral infection in gill, muscle
AB029337
  • F:CGGCGACACTCACTCCTC
  • R:TCTGATTGGTTGGTTGGTTGG
170 59 SYBR
UBCE[3] Ubiquitin-conjugating enzyme
  • 24h post-viral infection in heart, muscle, intestine, kidney
  • 72h post-viral infection in in heart, intestine,kidney
AJ298327
  • F:CACCATCACAGGACCGAATG
  • R:GATGTCAAGGCAGATGCTACC
170 59 SYBR
TUBA[3] α-tubulin
  • 24h post-viral infection in heart, muscle, intestine, kidney
  • 72h post-viral infection in heart, intestine, kidney
JN635277
  • F:TGACATCACAAACGCCTGCTTC
  • R:GCACCACATCTCCACGGTACAG
107 59 SYBR
EF1A[3] Elongation factor-1-α
  • 24h post-viral infection in kidney, spleen
  • 72h post-viral infection in intestine, spleen, kidney
AB240552
  • F:CTACAAGTGCGGAGGAATCG
  • R:GTCCAGGAGCGTCAATGATG
200 59 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Li Sun
  • Email: lsun@qdio.ac.cn
  • Institution: Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 Cite error: Invalid <ref> tag; no text was provided for refs named
  2. Zheng W, Sun L. Evaluation of housekeeping genes as references for quantitative real time RT-PCR analysis of gene expression in Japanese flounder (Paralichthys olivaceus)[J]. Fish & shellfish immunology, 2011, 30(2): 638-645.
  3. 3.0 3.1 3.2 3.3 3.4 3.5 Zhang J, Hu Y, Sun B, et al. Selection of normalization factors for quantitative real time RT-PCR studies in Japanese flounder (Paralichthys olivaceus) and turbot (Scophthalmus maximus) under conditions of viral infection[J]. Veterinary immunology and immunopathology, 2013, 152(3): 303-316.