Paralichthys olivaceus

From ICG
Revision as of 02:07, 17 June 2017 by ICG Expert4 (talk | contribs)
Jump to navigation Jump to search

Description

Paralichthys olivaceus-1.jpg
  • Japanese flounder (Paralichthys olivaceus) is an important economic fish species cultured worldwide.Japanese flounder (Paralichthys olivaceus), a species of flatfish, is one of the most important fish species cultured in Asian countries including Japan, Korea, and China.
  • Japanese flounder (Paralichthys olivaceus) is an economically important marine fish in Japan, China and Korea.

Before & After Bacterial Infection

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
TUBA [1] a -tubulin
  • spleen
  • heart
  • muscle
  • gill
AU050297
  • F:TGACATCACAAACGCCTGCTTC
  • R:GCACCACATCTCCACGGTACAG
107 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Li Sun
  • Email: lsun@qdio.ac.cn
  • Institute: Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, PR China

References

  1. Zheng W, Sun L. Evaluation of housekeeping genes as references for quantitative real time RT-PCR analysis of gene expression in Japanese flounder (Paralichthys olivaceus)[J]. Fish & shellfish immunology, 2011, 30(2): 638-645.

Cite error: <ref> tag with name "ref2" defined in <references> is not used in prior text.