Paralichthys olivaceus

Description

Japanese flounder (Paralichthys olivaceus) is an important economic fish species cultured worldwide.Japanese flounder (Paralichthys olivaceus), a species of flatfish, is one of the most important fish species cultured in Asian countries including Japan, Korea, and China.
Japanese flounder (Paralichthys olivaceus) is an economically important marine fish in Japan, China and Korea.

Gene Symbol	Gene Name	Application Scope	Accession Number	Primer	Size [bp]	Tm [℃]	Detection
TUBA ^[1]	a -tubulin	spleen heart muscle gill	AU050297	F:TGACATCACAAACGCCTGCTTC R:GCACCACATCTCCACGGTACAG	107	60	SYBR

Name: Li Sun
Email: lsun@qdio.ac.cn
Institute: Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, PR China

Gene Symbol	Gene Name	Application Scope	Accession Number	Primer	Size [bp]	Tm [℃]	Detection
ACTB^[2]	β-actin	24h post-viral infection in brain, gill, live, Heart 72h post-viral infection in brain, gill, liver, Heart	EU090804	F:CGCTGCCTCCTCCTCATC R:ATACCACAAGACTCCATTCCAAG	135	59	SYBR
eIF5A^[2]	β-actin	24h post-viral infection in brain, liver 72h post-viral infection in brain, Spleen	FJ390056	F:GAACGAAGAAGCCGCCATC R:GTAGGAAGGTTGGAGAACAGAG	193	59	SYBR
GAPDH^[2]	Glyceraldehyde-3-phosphate dehydrogenase	24h post-viral infection in Gill, Muscle 72h post-viral infection in Gill, Muscle	AB029337	F:CGGCGACACTCACTCCTC R:TCTGATTGGTTGGTTGGTTGG	170	59	SYBR
UBCE^[2]	Ubiquitin-conjugating enzyme	24h post-viral infection in Heart, Muscle, Intestine, Kidney 72h post-viral infection in in Heart, Intestine, Kidney	AJ298327	F:CACCATCACAGGACCGAATG R:GATGTCAAGGCAGATGCTACC	170	59	SYBR
TUBA^[2]	α-Tubulin	24h post-viral infection in Heart, Muscle, Intestine, Kidney 72h post-viral infection in Heart, Intestine, Kidney	JN635277	F:TGACATCACAAACGCCTGCTTC R:GCACCACATCTCCACGGTACAG	107	59	SYBR
EF1A^[2]	Elongation factor-1-α	24h post-viral infection in Kidney, Spleen 72h post-viral infection in Intestine, Spleen, Kidney	AB240552	F:CTACAAGTGCGGAGGAATCG R:GTCCAGGAGCGTCAATGATG	200	59	SYBR

Name: Li Sun
Email: lsun@qdio.ac.cn
Institution: Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China

↑ Zheng W, Sun L. Evaluation of housekeeping genes as references for quantitative real time RT-PCR analysis of gene expression in Japanese flounder (Paralichthys olivaceus)[J]. Fish & shellfish immunology, 2011, 30(2): 638-645.
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 Zhang J, Hu Y, Sun B, et al. Selection of normalization factors for quantitative real time RT-PCR studies in Japanese flounder (Paralichthys olivaceus) and turbot (Scophthalmus maximus) under conditions of viral infection[J]. Veterinary immunology and immunopathology, 2013, 152(3): 303-316.