Difference between revisions of "Patinopecten yessoensis"

From ICG
Jump to navigation Jump to search
 
(4 intermediate revisions by 4 users not shown)
Line 91: Line 91:
 
|}
 
|}
  
===Moleculer types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 100: Line 101:
 
*'''Name''': Xiaoli Hu
 
*'''Name''': Xiaoli Hu
 
*'''Email''': hxl707@ouc.edu.cn
 
*'''Email''': hxl707@ouc.edu.cn
*'''Institute''': Key Laboratory of Marine Genetics and Breeding (MGB), Ministry of Education, College of Marine Life Sciences, Ocean University of China, Qingdao, China
+
*'''Institution''': Key Laboratory of Marine Genetics and Breeding (MGB), Ministry of Education, College of Marine Life Sciences, Ocean University of China, Qingdao, China
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''??''' (Based on Google Scholar [2017-08-01])
+
Cited by [https://scholar.google.com/scholar?cites=11483243301522500014&as_sdt=2005&sciodt=0,5&hl=en '''27'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 113: Line 115:
 
</ref>
 
</ref>
 
<ref name="ref3">
 
<ref name="ref3">
Feng, Liying, et al. "Identification of reference genes for qRT-PCR analysis in Yesso Scallop Patinopecten yessoensis." PloS one 8.9 (2013): e75609.
+
Feng, Liying, et al. Identification of reference genes for qRT-PCR analysis in Yesso Scallop Patinopecten yessoensis. PloS one 8.9 (2013): e75609.
 
</ref>
 
</ref>
  
 
</references>
 
</references>
 +
 
=='''Categories'''==
 
=='''Categories'''==
 
[[Category:Different Tissues]]
 
[[Category:Different Tissues]]

Latest revision as of 05:21, 1 September 2017

Description

Patinopecten yessoensis-1.jpg
  • Patinopecten yessoensis which naturally distributes along the coastline of northern Japan, the Far East of Russian, and the northern Korean Peninsula, has become one of the main maricultural shellfish in the north of China since it was introduced in 1982 [1][2].
  • Common Name: Patinopecten yessoensis
  • NCBI Taxonomy

Different Tissues & Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
HELI[3] DEAD-box RNA helicase
  • Different tissues
NA
  • F:CCAGGAGCAGAGGGAGTTCG
  • R:GTCTTACCAGCCCGTCCAGTTC
186 62.8 SYBR
UBQ[3] ubiquitin
  • Different tissues
NA
  • F:TCGCTGTAGTCTCCAGGATTGC
  • R:TCGCCACATACCCTCCCAC
184 62.8 SYBR
RPL16[3] 60S ribosomal protein L16
  • Different tissues
NA
  • F:CTGCCAGACAGACTGAATGATGCC
  • R:ACGCTCGTCACTGACTTGATAAACCT
117 62.8 SYBR
CB[3] Cytochrome B
  • Different embryo/larva stages
NA
  • F:CCTCTCCACCCTTTCTAGTCCTTG
  • R:CTCCTGGTTCTTCGTCTTTCTCC
170 62.8 SYBR
CC[3] Cytochrome C
  • Different embryo/larva stages
NA
  • F:CGTTTTCTCCTGGTTCTTCGTC
  • R:TCTTCCTCTCCACCCTTTCTAGTC
178 62.8 SYBR
His3.3[3] Histone H3.3
  • Different embryo/larva stages
NA
  • F:TAGTATGACTTGCATGATCCGTAGAAA
  • R:GCCAGAAGAATCCGTGGTGAA
121 62.8 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiaoli Hu
  • Email: hxl707@ouc.edu.cn
  • Institution: Key Laboratory of Marine Genetics and Breeding (MGB), Ministry of Education, College of Marine Life Sciences, Ocean University of China, Qingdao, China

Citation Statistics

Cited by 27 (Based on Google Scholar [2017-09-01])

References

  1. Feng L, Yu Q, Li X, Ning X, Wang J, Zou J, Zhang L, Wang S, Hu J, Hu X, Bao Z. Identification of reference genes for qRT-PCR analysis in Yesso scallop Patinopecten yessoensis. PLoS One. 2013 Sep 19;8(9):e75609. doi:10.1371/journal.pone.0075609. eCollection 2013. PubMed PMID: 24069432; PubMed Central PMCID: PMC3777977.
  2. Jain M, Nijhawan A, Tyagi AK, Khurana JP (2006) Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochem Biophys Res Commun 345: 646-651. doi:10.1016/j.bbrc.2006.04.140. PubMed: 16690022.
  3. 3.0 3.1 3.2 3.3 3.4 3.5 Feng, Liying, et al. Identification of reference genes for qRT-PCR analysis in Yesso Scallop Patinopecten yessoensis. PloS one 8.9 (2013): e75609.

Categories