Difference between revisions of "Patinopecten yessoensis"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
[[File:Patinopecten yessoensis-1.jpg|right|200px|link=Patinopecten yessoensis]]
 
[[File:Patinopecten yessoensis-1.jpg|right|200px|link=Patinopecten yessoensis]]
* '''''Patinopecten yessoensis''''' which naturally distributes along the coastline of northern Japan, the Far East of Russian, and the northern Korean Peninsula, has become one of the main maricultural shellfish in the north of China since it was introduced in 1982. For the economic and ecological importance of this species, the first large scale transcriptome sequencing for scallops was performed recently in P. yessoensis, and over 20,000 genes were obtained. <ref name="ref1"/><ref name="ref2"/>.
+
* '''''Patinopecten yessoensis''''' which naturally distributes along the coastline of northern Japan, the Far East of Russian, and the northern Korean Peninsula, has become one of the main maricultural shellfish in the north of China since it was introduced in 1982 <ref name="ref1"/><ref name="ref2"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Patinopecten yessoensis'''
 
* <font color=blue>'''Common Name:'''</font> '''Patinopecten yessoensis'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=6573 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=6573 <font color=blue>'''NCBI Taxonomy'''</font>]

Revision as of 06:47, 10 August 2017

Description

Patinopecten yessoensis-1.jpg
  • Patinopecten yessoensis which naturally distributes along the coastline of northern Japan, the Far East of Russian, and the northern Korean Peninsula, has become one of the main maricultural shellfish in the north of China since it was introduced in 1982 [1][2].
  • Common Name: Patinopecten yessoensis
  • NCBI Taxonomy

Different Tissues & Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
HELI[3] DEAD-box RNA helicase
  • Different tissues
NA
  • F:CCAGGAGCAGAGGGAGTTCG
  • R:GTCTTACCAGCCCGTCCAGTTC
186 62.8 SYBR
UBQ[3] ubiquitin
  • Different tissues
NA
  • F:TCGCTGTAGTCTCCAGGATTGC
  • R:TCGCCACATACCCTCCCAC
184 62.8 SYBR
RPL16[3] 60S ribosomal protein L16
  • Different tissues
NA
  • F:CTGCCAGACAGACTGAATGATGCC
  • R:ACGCTCGTCACTGACTTGATAAACCT
117 62.8 SYBR
CB[3] Cytochrome B
  • Different embryo/larva stages
NA
  • F:CCTCTCCACCCTTTCTAGTCCTTG
  • R:CTCCTGGTTCTTCGTCTTTCTCC
170 62.8 SYBR
CC[3] Cytochrome C
  • Different embryo/larva stages
NA
  • F:CGTTTTCTCCTGGTTCTTCGTC
  • R:TCTTCCTCTCCACCCTTTCTAGTC
178 62.8 SYBR
His3.3[3] Histone H3.3
  • Different embryo/larva stages
NA
  • F:TAGTATGACTTGCATGATCCGTAGAAA
  • R:GCCAGAAGAATCCGTGGTGAA
121 62.8 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiaoli Hu
  • Email: hxl707@ouc.edu.cn
  • Institute: Key Laboratory of Marine Genetics and Breeding (MGB), Ministry of Education, College of Marine Life Sciences, Ocean University of China, Qingdao, China

Citation Statistics

Cited by ?? (Based on Google Scholar [2017-08-01])

References

  1. Feng L, Yu Q, Li X, Ning X, Wang J, Zou J, Zhang L, Wang S, Hu J, Hu X, Bao Z. Identification of reference genes for qRT-PCR analysis in Yesso scallop Patinopecten yessoensis. PLoS One. 2013 Sep 19;8(9):e75609. doi:10.1371/journal.pone.0075609. eCollection 2013. PubMed PMID: 24069432; PubMed Central PMCID: PMC3777977.
  2. Jain M, Nijhawan A, Tyagi AK, Khurana JP (2006) Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochem Biophys Res Commun 345: 646-651. doi:10.1016/j.bbrc.2006.04.140. PubMed: 16690022.
  3. 3.0 3.1 3.2 3.3 3.4 3.5 Feng, Liying, et al. "Identification of reference genes for qRT-PCR analysis in Yesso Scallop Patinopecten yessoensis." PloS one 8.9 (2013): e75609.

Categories